GenePrediction:GLEAN_6714 Details

Name: GLEAN_6714
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:553643..552120 (- strand)
Length: 1524
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:553643..553531 (- strand)
Length: 113
Type: CDS
Source: GLEAN
Position: GCSC_156:553440..553308 (- strand)
Length: 133
Type: CDS
Source: GLEAN
Position: GCSC_156:553255..553189 (- strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_156:553120..552806 (- strand)
Length: 315
Type: CDS
Source: GLEAN
Position: GCSC_156:552745..552120 (- strand)
Length: 626
>GLEAN_6714 class=GenePrediction position=GCSC_156:553643..552120 (- strand)
ATGGCCGATCTGCAGGGACGCAAGGTCTTCAAGGTCTTTAACCAGGACTTCATTGTCGATGAGCGCTACACAGTAACCAA
GGAGCTCGGCCAGGGAGCTTACGGCATTGTCTGGTAGGTCGCCCTTCTCCCAACCTTATCTTTAAACCGGCCGCTGTGTC
TGTTTTCTACCGGCGCATATGAGCTGACCCGGCATCCGTACAGTGCCGCCGTCAACAACCAGACAAACGAGGGCGTCGCC
ATCAAGAAGGTCACCAATGTCTTCAGCAAAAAGATCCTCGCTAAGCGCGCCCTGCGCGAGATCAAGCTTCTCCAGCACTT
CCGTGGCCACCGAAACGTGAGTAGTCAGCTGGAATCACAGCAGGACAGCCATGATTAACCCGGGCCAGATCACCTGCCTT
TACGACATGGACATTCCGCGGCCGAACAACTTCAATGAGACTTACCTCTACGAAGGTGCGAGCACTCTATCTGTGGCATG
CTGTTTGCGAGTAGCATAGGCTAACAAGTCCCGTTGATCACAGAGGTCATGGAATGCGATCTCGCTGCCATCATCCGCTC
TGGACAGCCCTTGACCGATGCCCACTTCCAGTCTTTCATCTACCAAATTCTGTGCGGCCTCAAGTACATCCACTCGGCGA
ACGTGCTGCATCGTGATCTGAAACCCGGCAATCTGCTGGTGAACGCCGACTGCGAGCTCAAGATCTGCGATTTCGGTCTT
GCTCGTGGCTTCTCCGTCGACCCGGAGGAAAATGCCGGCTACATGACGGAGTACGTCGCCACACGCTGGTACCGCGCGCC
TGAGATCATGCTGAGCTTCCAGAGCTATACAAAAGCCAGTACGTTATGCAATACGGGCCAGAACTCTCGTTTTGGTGACA
TCGACTGACGTGAAACAGTTGATGTGTGGTCGGTTGGCTGCATCCTGGCCGAGCTGCTGGGCAGCCGTCCGTTCTTCAAG
GGTCGGGATTACGTCGACCAGCTGAACCAGATTCTGCAAATCTTGGGTACGCCGAACGAGCAGACGCTGTCACGCATCGG
GTCTTCACGCGCCCAGGAGTACGTGCGCAACCTTCCGTTTATGGCGAAGCGCTCGTTCCAGTCACTCTTCCCCAGCGCCA
ACCCCGATGCCCTCGATCTGCTGGACCGCATGTTGGCATTCGATCCCAGTAGCCGCATCACGGTCGAACAGGCTCTCGAG
CACCCCTACCTGCAGATTTGGCATGATGCCAGCGACGAGCCAGACTGCCCGGCCACGTTCAACTTCGATTTCGAGGTCGT
CGATGATGTGGATGAGATGCGCAGGATGATTCTGAACGAGGTCTACCGCTTCCGCCAGCTCGTTCGCACCGTGCCGGGCT
CGGCAGGCCATGCTGCAGCCCAGGCTGCCCAAGCCCAGCAGCAGGTGCCCATGCCTGCTGGACACAGCCAGTGGACATCA
GAAGACCCACGCCCACAGGAGTACGTGAACCACCCTGCCGGCCTGGAGCAGGAGCTTGCTGGCGGGCTCGATGCGCGGAG
ATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62