GenePrediction:GLEAN_6715 Details

Name: GLEAN_6715
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:551694..551368 (- strand)
Length: 327
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:551694..551527 (- strand)
Length: 168
Type: CDS
Source: GLEAN
Position: GCSC_156:551391..551368 (- strand)
Length: 24
>GLEAN_6715 class=GenePrediction position=GCSC_156:551694..551368 (- strand)
ATGGGCAAGGTTCACGGTTCTCTGGCGCGTGCCGGTAAGGTCAAGTCGCAGACTCCCAAGGTCGAGGCTCAGGAGAAGAA
GAAGGTCCCCAAGGGCCGCGCGCACAAGCGGGAGCTGTACACTCGGCGGTTCGTGAACGTCACGCTGGCACCGGGCGGCA
AGCGCAAGGTAAGATTTGTATTTTTTGGAGCGGGTTTCGAATTTTTGCCCTAGGAGGGGCCCTGCTGTGCGAAGCCAAGA
TTTTTGGGAGGCGGGGAGAAGCACGAGATGCACGAGATGCTAACCGCGAAAACTCAAATTTAGATGAACGCCAACCCGAC
GGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62