GenePrediction:GLEAN_6716 Details

Name: GLEAN_6716
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:532733..531900 (- strand)
Length: 834
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:532733..532717 (- strand)
Length: 17
Type: CDS
Source: GLEAN
Position: GCSC_156:532605..532575 (- strand)
Length: 31
Type: CDS
Source: GLEAN
Position: GCSC_156:532522..532479 (- strand)
Length: 44
Type: CDS
Source: GLEAN
Position: GCSC_156:532415..532357 (- strand)
Length: 59
Type: CDS
Source: GLEAN
Position: GCSC_156:532273..532229 (- strand)
Length: 45
Type: CDS
Source: GLEAN
Position: GCSC_156:532159..531900 (- strand)
Length: 260
>GLEAN_6716 class=GenePrediction position=GCSC_156:532733..531900 (- strand)
ATGGCTACCGAGCAGACGTGAGTTCAATTCTATTCATATGTCTTACCATCTTGCTGGCCCTCCTACTTGATACCCCTTTT
TTTTCCTCTGCCATTGCCCTGGAGCTGTCTAAGCTAACATTGTCTCAGCTTCATTGCTATCAAGCCCGATGGCGTCCAGG
TTGGTGACGCTCTTTATGTGAAGTATCGCTTCCGCTAATCACCCTGTCCAGCGTGGCCTCGTTGGCCCCATCATCAGCCG
CTTCGAGCAGCGCGGGTTCGTTTATCTTTACCCGCCTCGTTACTGTGAAAGGGCTTTAAGTTGACATTCATGGAACAGCT
ACAAGCTGGTGGCCCTGAAGCTTGTCTCCCCCAGTCAGGAGCACCTCGAGACTCACTGTTCGTGACCGCACCCCCACCAG
AACATCGACACGCTGCAACAGATACCTACGGACAACTTACTAACTCTTCTTGTCTGACAGACTCTGACCTCAAGGACAAG
GCTTTCTTCCCTGGTCTGATCAAGTGTTCGTGTTTTCCAACGCTGCTCCAATGCATTAGCCCTCTCGCCTGCTTCACACG
CTAACTGCTACTAGACATGGGCAGCGGCCCCATCGTCGCCATGGTCTGGGAGGGCACTGATGCCGTCAAGACCGGCCGCA
CTCTTCTCGGTGCCACCAACCCCCTGAACTCGCTTCCCGGCACCATCCGTGGCGACTTCGCCATCACCACTGGCCGCAAC
GTCTGCCACGGCTCCGACAGCGTCGAGAACGCCAAGAAGGAGATTGCTCTGTGGTTCAAGCCTGAGGACCTGAACACCTA
CAAGTCTGCTCAGTACGACTGGGTCTACGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62