GenePrediction:GLEAN_6717 Details

Name: GLEAN_6717
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:528932..528269 (- strand)
Length: 664
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:528932..528707 (- strand)
Length: 226
Type: CDS
Source: GLEAN
Position: GCSC_156:528414..528269 (- strand)
Length: 146
>GLEAN_6717 class=GenePrediction position=GCSC_156:528932..528269 (- strand)
ATGTTTCTATCGTCGTTTGCAGAGCAGAGCTGGGAAGACCTTGTCGAGTGGGACCTTCACTATGCTCTATACCTTGCTAT
GCAATTTGGCCATGATGAGAGTTTCCGTATGATTTCACGGAGCTTGGCGGTATTCTGTCCTCCTCGGAATGGCAGTTCCA
GTCCTGCTCTATGGGCTGGCAAGATCACGGAGCACTTTGTTCACATTGCCATTGTGCCGGTACTTCGTGAGTGATGTGAA
AGAGCTCCTGGTAGACTCGCAGCATTACGAAGCTAACCTGTTGCTACCAGAGGCTATACATGGAGCTTGCACGCATGCAG
TGCACAGAGTGATACTCGAGGTTGAGAACTTCTTGTTCGGAAACGAACAGAGCCTTTGTGCAGAAGATAACTTGAGATGC
TGCACACAGATGGATTTCTTGGCAGCGTCCAGGCGGCGGCTTCGCCGTGGCCTTGTACTGACCGGGTTGTGGCCACTTGA
AGAGCTGTATGGTTTCAGTTTGCACAGCTTCGTGGCAGAAATCAAGGAGGCCGGAGAGGTGGATCTGGACTACGTGGATC
CTGAAGCTGCTGAAATCCGTTCCGAGTGCCGTTTCCTGACACAGCTTTACGAAGACTTGGACGATATCGTCAACAGCATT
GAATTCTCGATCTACTGGTTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62