GenePrediction:GLEAN_6718 Details

Name: GLEAN_6718
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:527376..524591 (- strand)
Length: 2786
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:527376..526115 (- strand)
Length: 1262
Type: CDS
Source: GLEAN
Position: GCSC_156:525366..525305 (- strand)
Length: 62
Type: CDS
Source: GLEAN
Position: GCSC_156:525231..525162 (- strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_156:525035..524591 (- strand)
Length: 445
>GLEAN_6718 class=GenePrediction position=GCSC_156:527376..524591 (- strand)
ATGGTATACCCCTACAGCTATCCGACGCAGCCGACTCCAGTATATCAATATGCCCCTGGCCATGGGTCAACGTCGACGGG
ACACGGCGTACGGCAGCACCAGACGACAGCGAGCACGACCTATCCCTTGGTCTACTCGACGCCATCAGCTCCACTGTATT
ATCCCCGAGTGCCTGCAGGCCCGATGCCTGCTCTACCGCCGTATACCTACTATCCACAGCACGTGTCGAGCGGTATGTAT
GGTCCAGCAGCGCCACCTCACTATCAGCAACAGAGCGGTGGGGGTGTCTTCAACCGCTGGCCCGGCGCTCCCGAGGAGGA
AGAGGTCAGAGCAGAGGACAGGACTCGGAGGCGGTCTCGCCGGGGCCACCGGAGCCGACAGGAACGCGGCCACCGCAGCC
ACAGCCCATCCAGATCGGGTGGCAGCAACAGCTACTACGACAGTCGGGACGGTGGCTACGCGAACGAAAATGAAGGCGAG
GACGACGACGTCGTTTTCCGTCTGCATGATGACGTCTTTTACGACGAGGACGATGAAGAGCATGTGGATACGCGTCTTCG
AGCCCACAATCTGGCTGTAGCCGGACGCGAGGAGGTTGCCTACGGCCGGGGGGACAACGACGACGATGACGACGAGGCGG
ACGATGTCGGCGAGCTGGTGCGCGAGGTGGCCGTGCATCCGGGAGGCTCAGGGCGGGTGGTTCTGCACGTGGATAGCGAG
CCGCCGCGGCTGACGAGTTTCCGGGTGTCAGCGCGGCGAATGCGCAGCGAGGCACGGTCGTGGACGCAGGTGTGCCATCG
CGGGACCAATGCGTGTGACACGACGGTGGCCGACGAGACAGCCGTGGCCGGCATGTATTGGCTGCTGCGGGTGTTGCACG
ATGAGCCGGAAGTCAGGGCTGATGGTGCGAGCGGACATCAAGACCATCACGCCTACGAGGCCCGGCTGCACAACCTTGTC
GTCCAGGGAGCTGTGCCGGTTCCACGCGAGCTGCCGGCACGCGTGTTGGCATATGTCGTCATGTTTGGGCAGCAGCTTGG
CGCACTGGGACGGCCGGGATCGATGGGGGGTGGCGGACGGCCCAGCAGCCGTCTCCGGACTCAGTCGGAAGCGTGGCTCT
GGGCTATTATGAGCCGACGACGGGACCGACACGTGCTGGATGCGTCAGCTGTGGACGACTGGCCGTTTCTGCTGTACGCT
TCGCGCTCGCTGGATAACCAGGATTTAGTGCGGCGTTGTCTGCAGATGCTGACGTGGGATCGGTAGGTTTTTGAAGACGA
TGGGCGTGAAGGAGGATGTGAAGAGGAGAGCACAACAGGAAGAAGGCTGAGGGAGACGGGGAGAAGAAGTCGAGGTGACA
AAGATTAATCCGAAAGAAAGCAGAGCCGTACGATAGCTACGAGGACCTCGGTAGCTGATGGGTACTTAAGCAGAACCCTC
TAATAAAGAACATTGAACAGCATTCACATGAGCTTATAGACGAAATGTAGATCTCAGAAATGAAACTGCCAACAGACGGA
AAACTGCAGGCAGAGATTAACGAAGGATCCCTCTTTACGGTTGTTCTACGAGCGCCCATCAGGCACGACCACTCCAGAAT
GAAGCAGCCATGCCTGAACCGCCGCATGACAGCAGTCACTGTGGGATCTGCTGACGGTGGCGGCAGAGCGCTCGGTTCTA
TCTGAGGAAGAAAAAGAGAAGGGGACGAAGCGAGAGGCGGCAGATTTTTGTTTTATTTTGTGTCTCGCGATCCACCTACA
ATCACGTGCAGCGGAGCGCAAAAACATGTCGGAAGTGGAGGAAGCGGAGTGCCGGGGAAGAATGACAAAGGGAAGAATCG
GGCGGCTGCTGATTGGCCAGCCCCAGCTTGTGCTTTGTGAGAGAGCCGAGGACGACCGAAGAAAATAGCCGGCAGCGGGA
CGGATTGGCTTCTGAACGTCATCATCTCTTCCACTCGCAACCACGACCACGACAGACTTGGGACGCTCTCGGACTTTCCA
CGCATCACAGACAACGGAACGATTGGCTGACGATGAATGCCCAACGGGTCGGCGTGATGGCGCTTCGACGGGGTGAGTGG
TGATGAGGGGGGAGGGAGCTTTAGGACGATGAGCAGACAGAGGAGCATTGCTGACAATGATGCAGCTGCTGCGAAACCGT
CGGTGTTTTCTCCCCAGGTTGCCCGTGCTCTGGCACTGCGGGCGGTGCAGACGAGGTGAGATAAATGTGTCTTGTGTTTT
GTATTTCGCCTCTTTTGCCTCTTTTCCGTCCACATAGTCTTCCTCTTCGTCTTTTATTCTCCCGTCTTTCCGTCTCCTAC
TCTTGTCTCCTAACACCTCAGATCCTTCACGACGGAGAAGCTCACGCCTGAGCAGGCCAACGCGCTGCTGGCATCGCAAC
GGCTGCAGCGGCCGGTGTCGCCGCACCTCGACATCTACGACAAGAGGCAGATCTACTTCGGCGCGTCGATCCTGCATCGC
TTCACCGGCCTGACCTACGCCGGCCTGCTCTACGGCGGCTCGCTGGCCTACCTGGCCGCCCCGTTGCTCGGCTGGCACCT
CGAGTCGCAGAGCCTGGTGACCTTTGCCGCTGGCCTGCCGCTGGCTCTCAAGGGCGTCGCCAAGTTCGCCCTCGCCTGGC
CCCTGGCCTTCCACTTCTTCAACGGCGCCCGCCACCTGGTCTGGGACGCCGCGGTCGGCTTCTCCAAGGCCGAGATCGCC
AAGGGCACCACCGCCATCTGGGTGCTCAGCGTCGTCTCCAGCCTCGGCTTGGCGTTCTTGTGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62