GenePrediction:GLEAN_6719 Details

Name: GLEAN_6719
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:522155..520889 (- strand)
Length: 1267
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:522155..521920 (- strand)
Length: 236
Type: CDS
Source: GLEAN
Position: GCSC_156:521855..520889 (- strand)
Length: 967
>GLEAN_6719 class=GenePrediction position=GCSC_156:522155..520889 (- strand)
ATGACCGCCCCTTCGCGGCCCATCCCGGCCCTGTACACCGTTTATATTCTTCGCTCGACGATGCGTCATGCCTCGCTTTA
CATCGGGTCCACACCAGACCCGCCCCGCCGGCTGAAGCAACACAACGGCGAGATTCGCGGTGGTGCAGCGCGGACTTCTC
GAGTAAGGCTGCGGCCATGGGAAATGGTCGGGCTGGTGTCGGGCTTCCCTGGACTGATTGCGGCCTTGAAGTTCGAGTGC
GTTGCAACCCAAACTTGCTCTGTTGCGTCCCGCTCTCTCCTTGTGCTGACGATACCCCAGATGGGCACTGACGAATCCCC
ATCGCTCGCTCCACATCCCGTCAGAATCACGCTTGACTGTATCGAAAAAGACAAAGAAGAGCGGCCACTTGCGAAAGCCG
AGCAAGAGCATGCAGTCGATTCTTGCCAACCTACATCTGCTCCTGCGCGTGCCCAGCTTTGCGCGCTGGCCGCTGCGACT
GCACCTGTTCGTTCCCGAGGTGCATTCAGCATGGCAGAAATGGTGTGCAACGACCGACCTGCCGATGCCAGATACCTTTG
AGCTCGTCACAGATTTCGGACCGACAGAGCCCCAACCTAAGCAGCCTCGAGGACGAGCTCGCGACACCGCCGACACGGCG
CCTTTGACACCAGAGGACGGAGAAGCGCTGTGGGGAATACACGCGCTGCCGCTGGATTACACACCATTGCGTGACTACGT
CGACAAAGCACGTGACATTTTTACGTTTGAGCGAGAGGGCAGCTGTGCGATATGTCACGAGCACATGCCTTCAGGGCAGG
GCCTCTATGCGGTCTGCCCAAACACGTCTTGTGAGGCCGTAGGACACTTGTGTTGCTGGAGCCAGCACGTTCTCCTCAGC
GAGGCCGACGCCGAAAAGGAAGGCATTCTCATACCAGTTCGAGGGAAATGCCCAAAATGCGACGGGAAGGTCGAGTGGAG
TGACATGATGAAGGAGCTGACGCTGCGGTTGCGGGCGCCGAAAGAGGTGGACAAGCTGGTCAAGACGAAGCGGCGGCTGG
AAAAGGCAGCTAAAAAGGCGGCAGACAGGCCTAGGACTGCTGCCGCAGTCGAGTCGCCGAAGAAGCCGACAGCAGCCACA
AGACGGAGCCCTGCAAAGCGCACTGGTAGGGCCGCTAAAGCGCCGAAAGAGACAGCACCCAAGAGGAAGACAAAAGGCAG
CACGACAGCCAAGTCAAAGCAGACCAGCTCGCCGGAGGTCATCGTGCTGGAAAGCAGCGAAGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62