GenePrediction:GLEAN_671 Details

Name: GLEAN_671
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1331117..1334683 (+ strand)
Length: 3567
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1331117..1332666 (+ strand)
Length: 1550
Type: CDS
Source: GLEAN
Position: GCSC_97:1332730..1334683 (+ strand)
Length: 1954
>GLEAN_671 class=GenePrediction position=GCSC_97:1331117..1334683 (+ strand)
ATGGCCGATAAGATCACGCTCGAGCAGGCCGACCAGCTGCAGGCGATCCTGGTGGCGGATGTGTCCGTCGACGTTAAGGT
GCAGCATGTGACAGCGGCCAAGTCGAGCATCAAGCAGCACAACGTGCCGGACAACGTGGTGGGGCCGCTGTTTGAGGCGC
TGCGCACGGCGTCGACGTCACAGCACGCGGCCCTGGTGAATGCCGGGTTCACGTCGGTGAATCATCTGCTGACGCGGCTG
TCGCGCCAGGAGCCGAAGCTGCTGATCAAGGAGGCAGCCCGCACGCTGCCGCTGATTATCGAGAAGCTCGGCGACCTCAA
AGAGAAGTACCGCAGCCTGGCGATGCAGGCACTGACGACGTTGCAGCATGTGGCACCGCTGGATGTCGAGCGCTTCGTCC
GCAACACGGCCATGGTCGGCAAGAACCCGCGAGCCAAGGAGGCCAGCATGCAGTGGCTGCTGCAGATGCACCACGACCAC
GGCATGCCGTTCCGTGCCTACGTCCCCGGCCTGATGGAGCTGCTCGAGGACGCCGACGGGATGGTGCGCGACGCCGCCAA
AGCCACCGTGCTCGACCTCTTCCGCTCGGCTCCCAACGCTGCCAAGGCCGACCTGAAGAAGCAGCTGAAGATCTTCAAGG
TCCGTCCGGCCATTGAGCAGGCCATTGTCCGCGAGCTCGTGCCCACATCCGTCTCTGCTGCTGCTGCTGTTGATGACGTC
CGCCCCGAGTCTCTCCAGCCGGCTCGGCCACCGTTGCGATCGGCTGTGTCCGTCTCGAACCTCTCCAACTTCTCGGCCAG
CGTTTCGTCCACGTCAGGCCCTCCCCAAAGCCACGACCGCCCCGTCACACCCTCGCCCGAGACAGCTGGTCGTGCCGAAC
CGGTCGAGCCGTCGTACGTCAACACACAGCGCGAGCTCGACGACATGCTCCGCGACATGCACGCCTGGTTCGACGGCAAG
GAGACGGAGCAGAACTGGCTGAAGCGTGAGGAGAGCATGACGCGGCTGCGCCGCCTCATCGCCGGCAACGCCACCGACTT
CCAAGAGGCCTTTCTGACTGGCGTCCGCAGCCTCCTTGACGGCATCCTCAAGGGCGTCAGCTCGTTGCGCACCAGCCTCA
GCAAAGAGGGCTGCAGTCTCGTCCAGGACCTCGCCAACATCTTCGGCCCCGGCATTGACCCCATGGTCGAGCTGCTGCTC
CAGACGCTCATCAAGCTCTCGGCTGGCACCAAGAAGATCAGCTCCCAGCAGGCCAACGCCACTGTCGACGCCATCATCGC
CAAGGTCACGTACACCAACCGGATCATGCAGCACGTCTGGGCCGCCTGCCAGGACAAGAACGTCCAGCCGCGCACCTACG
CTGCCGGCTGGGTCCGCACCATTCTCAACCGCGAGGCCCGCCACAAGGAGCGCTTCGAGCACTCGGGCGGCCTCGACCTC
CTGGAGAAGTGCATCAAGAAGGGCTTGATCGACCCGAACCCGGGTGTGCGCGAGCGCATGCGTGCCACCTTCTGGGCCTT
TTCCCAGTTCTGGCCAGCCAAGGCCGAGGCGTAAGTGCAAGCCGTCCGCCCTGGCACTCTGCTTGATTTTGTTCGTACGC
GCTGACAGCATAGAATCATGTCCACGCTGGATGCCACGGCGCAGAAGCTACTGCAAAACGACCCGAACAACCCGAACTCG
CCCAAGAAGGGTGGTAGCACGGCCACCCCGGTGGCACGAACGGGCCTGGGCCTGTCCAAAAGCACGATGGGGTCGGCGAA
GCCGTCGCTGCGGGAGACGATGTTGGCGAAGAAGAAGGAGGCCCTGGCCACGCGCAATTTGCCGACACGTCCTGGTTCTG
CCATGGCCCAGTTCTCACCCGTGCGGACGGGCTCTGGGTCTGGATCCTCGTCCTCCGCTGCAGCCGGTGCCGGGTCAACA
TCGTCTCTGGGTCGGCAACGGGCAGAGGGTGGTGGTGGCCTGTCCAATGCCCCGGTGCGGCCAGCAAAGCGGCGACCCGA
GCTGCACGCACGACCTGCCACAGCAGGGCCATATTCTGTTCGTACCCACGAAGTAACGATCGAGCAGTCGAGCCCGCCAG
AAAGGCTGCGGTCTAGGAACGCCGTGACGCCAAAACCACTGGCATCCTCGCCCAAGAGAACGACAGGAGCGAGACCGCGG
ATGGGACATCAGGCAACCGTCAGCGAGTCGAACCTGGTATCGCCATCCCGCGCCGCCGCAGCTGCGCTTTCCAGAGCCAC
AGCGGCCAACACAGCCAACGCGTCTGCAGCGGCACGGCCACAGTCGAGCCATATGTCAGTAACGCCACGCAGCAGCCCGG
CAAGACCAAAGTCCATGGTCGCTGTCGTTCTTCCGGGCGCCGGAAGCAGCCCGATACGGTTCCGAGGAGGCGGAGGAGCA
GGGACGGCCGCACACAGTGTCGGAGACGAGAACATGGTATTTGCCAAGGTGATGGACAGAGAGGCATCGCCACCACCGCT
CAAGGTGTACGAGGACCCGTTTTCGCCCGACGACCAGGACATGTCCAAGAAGGCGCTGCCGCTCTTCAGCACGACGGCAC
TGGAGGACAAGCCGATCAACGAGGACGCGGCCAATCTGGTGCGTCTGACGGACGACAACGGCACATCAAGCGTGACCTCC
ATGACGGCAGCCGTGGCAGCGATGGGGATCACGCACCCAAACACCGGAGCAGGAGCAGCGACAGAAGACATGCGGCAGGG
AGAGCAGATCTCAATATCACCTGAGAAGCTGCGGCAGAACACGCGGCTGCTGGACAGTGGCATTGCCCGGGTCAAGGCGC
AGTCGCTGGACGTGCATGGCTTCCGGCGGCTGCAGGGCATCATCCGGGATGCGGGCAGCATTGGTGGTGGCAGTGCCAGC
AGCAGCGGCAAGACGGCCGCGGTGCTGACGGACGCGCGGTTCGACTCGCTGCTGCTGGGCCTGTTTGCATATCTGGAGGC
GCCACCAACAGCGGCAACGACAGCGGCAGGAGCGATGAGCGGAGGAACAGACAAGGCGCAAGACGTCAAAGCACAGATCC
TGGCGACGATCAAGCTGCTGCTGAAGAAGGGGCGGGCGAGCTTCCAGCCGCACGTGTCGCGTGGTCTAGAGGCGCTACTG
GCGTCACGCACGGCGTATGACGCCCGCACGCACATTGTGGCCGGGCTGGAGCTGCTGGCCGACGAGCTGGTGACGCTGGG
CGACCCGTCCGAGATCGTGCTGGTGCTCGCGCGCGGGCTGAGCCGGGAAGACAACGGCGGAACAGGATTGGCGACGTCTA
GCCACTCGCTCAGCATGGGACTGCACGTGCTCAAGGTGCTGGTAGATGTGCGGCCAGCTTTTAGGCCGACCGATGCCGAG
CTCGGCCTGCTGCTGACCGGCCTGGCACAGCGCTGTCTCGAGAGCAGCGAGTCGGGCGTGCGCATGGACGCGGTGCAGCT
GTGTGTGGCCGTACACGAACGCGTCGGCGACACGCGCTTCTGGGCGGCGCTGCCAGGGGTCAAGGATGATCCGCGGAGCT
TGATCACGTATTACATTGTGAAGCGACAGAGGGAGGTGAAGGGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62