GenePrediction:GLEAN_6720 Details

Name: GLEAN_6720
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:518485..512750 (- strand)
Length: 5736
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:518485..517877 (- strand)
Length: 609
Type: CDS
Source: GLEAN
Position: GCSC_156:517782..517734 (- strand)
Length: 49
Type: CDS
Source: GLEAN
Position: GCSC_156:517671..516949 (- strand)
Length: 723
Type: CDS
Source: GLEAN
Position: GCSC_156:516872..516794 (- strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_156:516590..514020 (- strand)
Length: 2571
Type: CDS
Source: GLEAN
Position: GCSC_156:513968..512750 (- strand)
Length: 1219
>GLEAN_6720 class=GenePrediction position=GCSC_156:518485..512750 (- strand)
ATGATGGCGATCGTCCCTACGCTGCCCGGCTCCGGCTCTTCTGCCTCGGGTGCTGGCGGTGGCGGAGGAAGAAGCAGCAG
CAACAACGGGGGCAGTACAGGCTCTGCAGGCGACCGCGCTGCATCAGGAGCCAAGTCCGCAGCTGTCGGAGGAAGCAAGA
GCGCGGGGAAGAGCTTGGCGAGAGGCGCCTCGGGCGCAAATTCCCTGGCATCCGGAAGCTCTCGGGCCTCTCCTGCTATT
GGCTCCTCCGCAGGACATCCTGGCAGCTCCTCCGGGTCCAGCAAGCACAAAACCGCCCATACCAACGCTTGCCACGGCAA
CTCGATAAACACCCCCCTCCCACCGCCGCCTCTCAGCTCCATGGTCAGCGCGGCATTGGATCTCAAATCCGTTGAGCGTC
GCGGACAGCCCACGGCCAGCCGAGAACCAGGCAGAAGAAAGAACAGACCGCATGAGCTTGAAGAGGCGCCGACCTATCGT
CCAACCGAAGAGGAATGGAAGGACCCTATGGAGTATATGCGCAAGATTACCCCCGAAGCACGCAGCTATGGGTTGTGCAA
AATCATCCCACCTGACTCTTGGAATCCGCCATTCGCCATTGATACACAGGTTTGCAGCGATCCCCTCCCTGACCGGCTAG
GAGAATGCACCGGTTGATACACATCCCTAACAGGGACTACATCTTGCTGACAACGCTCTCTAGAGGTTCCATTTTCAGAC
GCGCAAGCAAGAACTGAATTGTGTCGAAGGCAGTAAGTTTCCTGCGCCGTTAACCATGTATTATCGTCTGCCTGCTCACA
TATTCGCCGATTAGGCACACGCATGAACCTCAGCTATCTTGAAGGGCTCTTTAAATACCACAAGAACATGGGCAATAATC
TGACTCGTTTGCCGTACGTGGACAAGAAGCCCCTCGATCTCTATCAGCTAAAAAAGGCTGTCGATTCCCGAGGTGGCTTT
GACATGGTCTGCAAGCTCAAAAAATGGGCCGAGATTGGACGCGATCTCGGATACAGCGGAAAAATCATGTCATCTCTCTC
GACATCGTTGAAAAACTCGTACCAGAAATGGCTTTGTCCCTATGAGGACTATCTCCGTAAGGCCAAACCGGGCGTGCACC
AGCAGCTGGAGATGGAGAACGGCGGTCCGTTCGTTCCAAGTCCTGGGGCAAGTCCCTTGAAGCGGTCGACTGTCAACACG
CCGTCAAGTGCACGCGGTGATTCACCTGTGCGCCAAGCAAGCGACGCGTTCCAAGTGTCATTATCTAGAAACACGGACGG
AAGCGATTGCGATACTCCGGCAACTTCAGAGAGCACTCCTCCTGCCTCAGCCTCGGGAGGATTCACGTCCTTGAATGCGG
CTAGTCGTAACGGCAGTCCTTTCACACCGACAAAGAATCCGGCCGATCAACGTGTTGCACCAACACATCCGCTCAAGCGA
CAGTTGAGTAACGGCACTCCGGGCTCACCCGGGAAGGAAGAGCTCGGCGAGGAAGACGAAGAAGGCAATGGCCGGCGAAG
CAAGCGGCTCAAGAAAGGTAATTTGTTACTTGTTCAACATGCTTTGCTTGCAATACCGCAATGCTGACAACCCACTCTAG
AAACTGTTCCTAGAGTTGCTGGTTCCCATATGTCGCTGCTTCGTCCTCCCCAACCGCGAATACCTCGAGATGATAAGAGC
GATCCGCGAGAAGTAAGCTTTCCCAGGACAGGACGGAGAAAATGGCAAGACAAGTCGAGATCTAACATGTCCCACGTGCA
GTCTTGTGAGCAATGTGCCAAGGGCGAGGAAGCCGGTTTCCTCATTCTTTGTGAGTCCTGCGATCACGCCTACCACGGCA
AATGTCTAGACCCTCCGATACTTGCGAAACCGGAATCGGAATGGAACTGTCCAAGGTGTCTTGTCGGCGATGGCCAATTT
GGCTTTGAGGATGGCGGCATATATTCTCTTAAGCAGTTCCAGGAAAAGGCCTCGGAGTTCAAGCAAAACTACTTCCAGAA
GAACATGCCGTACGACTCGGCAAACAACTGTCATCGCCCGGTAACGGAGGACGATGTCGAGCGGGAATTCTGGCGCCTTG
TGTCTAGCATCGATGAGACTGTGGAAGTGGAATACGGCGCCGATATACACTGCACCACGCACGGCTCCGGCTTCCCGACC
ATCGAGAAGAACCCCGACGACCCATATTCGACTGATCCTTGGAATCTCAACCTCCTTCCCCTGCATCCCGAAAGCCTGTT
CCGGTACATCAAAACCGACATCTCGGGCATGACAGTACCCTGGGTCTATGTCGGCATGATATTCTCTACCTTTTGCTGGC
ACAACGAAGACCACTACGCGTACTCGGCCAACTATCAGCACTTTGGGGCGACCAAGACCTGGTACGGCATTCCCGGCGAA
GACGCTGAGAAGTTTGAGGCTGCTATGAAGGAGGCCGTGCCGGATCTTTTCGAGACCCAGCCGGACTTGCTGTTTCAGCT
TGTCACGTTGCTTCCCCCAGAAAAGCTGAAAAAAGCTGGCGTCCGTGTCTATGCCGTAGACCAACGTGCAGGACAATTTG
TCGTGACATTCCCTCAAGCGTATCACGCAGGCTTCAATCACGGCTTCAATTTCAACGAGGCCGTCAATTTTGCTCCAAGT
GATTGGGAACCATATGGCCTCGCCGGGGTAGAGAGACTCCAGCAATTCCGCCGTCAACCATGCTTTTCTCACGATGAGCT
TCTCTGGACTGCTGCCGAGGAAGTGACTAGTGCTAGCACTGGACCGCTAACAATCCAAACCGCAAAATGGCTAGCACCAG
CGTTTGAGCGATTATACAATCGAGAAGTGACATCTCGAAATATCTTCATGTCTAGGCATCAGGAGATGGCACACCGCTGT
CCCCTGGCCGAAAATGAGAACAGTGCAAAAACGGAGAGCCTTGCGACAAACTGCCCACTGGAGTCTGTGGTCGATGATGC
CAAGGTTGCTGAAGAGGAATACCAGTGTTCCCACTGTAAAGCCTTTACATACCTATCTCGGTTCAAGTGCGTGAAGACGG
GCAAAGTCCTCTGCTTGCAGCATGCCGGCTTCCATCATTGCTGCCAGGCGCGAGAGACCAGCCGGTTTTTCGGAGAGGCC
CATATCCTGACCTATCGGAAGTCTCTGGACGAGATGTCGGCTATCTACAAGAAGGTTTCCGAAAAATCCCAGCAGCCTCA
AGCCTGGGAGGACAAGTACGAAAAGCTGCTGGATGAGGATGCAACACCCTCATTGAAGACTTTGCGGGCACTGCTTAACG
AGGGAGAGCGCATTCCGTACGAGCTGGCTTCATTGCCAATGCTGCGAGAATTTGTCGATCGGTGCAACAAATGGGTCGAG
GAAGCCACAACATATATTGTGCGCAAGCAGCAGAATCGCCGCAAGAACGAGAAAACCTGGCCAGGTGGTTCCCGCAAGTC
AATAAGCGGCAGTAGCGCCGAGGTGGACGACAAAGAACGGGATTCTCGCAACATCTCGAACATCTACCGTCTGCTTAGCG
AAGCATCCCAGATTGGGTTTGACTGCCCCGAGATTCTGCTCCTGCAACAGCGAGCCGACGCGATCAAGATCTTCCAAGAA
GACGCACACCGGGCGTTGTCACACGCTTCCTCCCAGACTGTGGACACGATCGAAAAGCTCCTGGATGAGGGTCATAGTTT
TAACGTGGATGTGCTCGAAGTCGAAAATCTAACAAGATTTCTCGATGAGCTGAAATGGACGCAAAAAGCAGAGACAAGCC
GCGGCGTTTACATGACATTGGAAGACGTCCTGAAGCTTGTTGAAGAAGGCCAGCGACTCGAGATATCGCCCTACAACGAC
CTCATGACGTACTTTGACGAACGCGCCGTCGCAGGAAAGCAGTGGGAAAGAACGGCTAAAGAACTTCTCGGCGCCGAGTC
GGTGCACTACGTGCAGCTGGAAGCTCTATCGAAGCAAGCAACAAGCGGGACAATACCGGTGTCTGAGGCAACGCTAGTAG
CAATCGACCAGATGCTCCACAAGCTTCGAGACGCGCAGCGGCAGATCACAGACCTGAACACGCGATCGCACGACTCAGAA
TACCGTAACCGGCCGCGATATTCAGAAGTTGTAAGTCTCATGACCAAGATCGAGGAGCTTCAGGCCAAACCCGGAGGGAC
CTTGGATCTGGAGAAAGAGCAGAAGCGCAACGAAGATTGGATCCGCAAAGGAAAGCGAGTCTTTGGCAAGACAAATGCGC
CTCTGTATATCTTCAAGTCGCACTTGGAGTATGTGCTCGACCGGAACAACGACTGTTTCGACACGGTTTACGACAAGCCT
CGTACGCCGACAGAACCGGCGTCGCGGGAGCCCAGTCCGGACTCGACGTCGCCGCAGAAGAAGAACTCTCGGAGCCGGAC
CGTGTATTGCATTTGCCGCCGTGTTGAAGCCGGCATGATGATAGAATGTGAGGTGTGCCACGAATGGTAAGTCTGACTCC
CGATTCCCAGCCGCCGAACTGGATCTAACAAGGATAGGTACCACGGGAAATGTCTGAAGATTGCACGGGGTAAAGTCAAG
GAAGACGACAAGTACACTTGTCCGATATGTGACTGGCGGCTCAAAATCCCGCGCGATGCAGCTCGACCGGATCTGGCCTC
GTTGATCAGCCTATTCAACGACATTCCTAATCTTCCTTTCCAACCGGAGGAGGAGCAGATTCTCGAGGACATCATACAGG
GTGCGATGGAATTCCACGACAAGATCGAGCCGTATCTGGATCCAGCTCGAGAGTCGGAGATCGACGTGGACATATTGCGG
TACTACCTGCGGAAGATTGAGGGTGCCGAGATACTCCTGACCCACGAGACCAACTTCTTCCGGCAGGCACTCCACAAACG
CGTGCCCATTGCGCTAGAAGCACCGCCGATGATTGAAGAGTCGAAGAGCACGCGCAAGCCGCGGCCGACAAAGCTGCAAA
AGATGATGGCGCAATTCCAGGTGGATGACCCGGAAGATCTGCCAGAACGAGTCAGGTTGCGAGCAAACAGCACACGCCGC
AGGATGCTGAACGCGGCAGATACGACCACAACAGCCTTCCGGGCGTCTGGACCGATTGGCCCATTGGCTCTCGGCAGTCC
TTCCCAGTCGCAAGAACAAAACTCGTCTCTGGCGACACTGCGGCGCAACAACGCAACGACGTCGTCCCCAAGCCATGCAG
CTGCGGCTGCTTTTGACAGCCACTCGCACGGACGCGTATTGAGCAGTGCCTCCAATGGAGACCGACGAACAGGACCTTTC
CCGATGCAGCTCGACAGAGGATACGGCACGCACTCGAAGGCTGATAGCAGCATCAGCGGGCCTCCGACATCAGAGCAGTC
TGGCGAGATATCAAGGCTTCTATCTTCACACGAGGACTCGGTGTTGAAGGAGCGGCTTTTGCGGGGTGACTTTGGTACGG
CGGACATCAAGGCGCTGCCGGAAAAGGATAAGGAATCGGTTTTTGAACTTCTGCTGCGGAATGCAGAAGGCTCTCGGCGA
GCACGAGAGTTATTTGGCCGAGGTGAAGATGGACGGTCAGGAGCAGACGACGATAGCGCGGACCGTATGGATGTGGACAA
GGCAGAGCAAGAGACGTTCGGCACTGGTGACGACAAAAAGGGGGGCATCGGAAAAGCAGAAAGTGTGGCCAAGGCGGTGG
CGGCGAATCTATCGGCTGGATTTGCGGAGAAAGAGAGTGAGGCTGGGGGTAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62