GenePrediction:GLEAN_6721 Details

Name: GLEAN_6721
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:506906..505560 (- strand)
Length: 1347
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:506906..506795 (- strand)
Length: 112
Type: CDS
Source: GLEAN
Position: GCSC_156:506712..505672 (- strand)
Length: 1041
Type: CDS
Source: GLEAN
Position: GCSC_156:505618..505560 (- strand)
Length: 59
>GLEAN_6721 class=GenePrediction position=GCSC_156:506906..505560 (- strand)
ATGGCCGAAGCAAGTGGAAGCAATGGCAAGGGCAAGCTGGACGACCGTGTCGACCTGACGACGTCGAAGGAGGTGAAGGT
GTTTCCCACGTTCGAGTCCATGTCACTAAAGGGTAAGAACCGCCAGGCGGCCCGCGAGGTCTTTTGGATCTCGTTTCTTC
GCGTATACACTCGCTCTAACACGCACCCCGGCAGAGAACCTTTTGCGTGGCATCTACGCCTACGGCTACGAGACACCTTC
GGCCGTGCAGTCCCGCGCCATCGTGCAGGTATGCAAGGGTCGCGACACGATTGCACAGGCCCAGTCGGGCACAGGCAAGA
CGGCCACCTTCTCGATCAGCATGCTGCAGGTTATCAACACGGCATCGCGTGAAACACAGGCGCTGGTGCTATCGCCGACG
CGCGAGCTGGCAACACAGATCCAGAGCGTGGTCAAGGCACTCGGCGACTACATGAACGTGCAGTGTCACGCCTGCATTGG
CGGCACGAATGTGGGCGAGGACATCCGGAAACTGGACCAGGGCCAGCACATTGTGTCGGGCACGCCCGGACGCGTAGCAG
ACATGATTCGACGGCGACATCTGCGCACGCGCAACATCAAGATGCTGGTGCTCGACGAGGCGGACGAGCTGCTCAACCAG
GGCTTCCGCGAGCAGATCTACGAGGTGTACCGCTACCTACCGCCGGCCACACAGGTGGTGGTGGTGTCGGCAACGCTGCC
ACAGGACGTGCTCGAGATGACGTACAAGTTCATGACGGACCCGGTGCGCATCCTTGTCAAGCGTGACGAGCTGACGCTCG
AGGGGCTCAAACAGTACTTTATCGCGGTGGAAAAGGAGGAATGGAAATTCGACACGCTCTGCGACCTGTACGACACGCTC
ACCATCACGCAGGCCGTCATCTTCTGCAACACACGGCGCAAGGTCGACTGGCTGACCGACAAGATGCGCGAGTCCAACTT
CACCGTCAGCAGCATGCACGGCGACATGCCGCAGAAGGAGCGGGACAGCATCATGCAGGACTTCCGTCAGTTCAACACGC
GCGTGCTCATCTCCACCGACGTGTGGGCACGAGGCATTGACGTGCAGCAGGTCAGCCTGGTGATCAACTACGACCTTCCT
AGCAACCGGGAGAACTATATCCACCGCATCGGACGGTCCGGCCGTTTTGGCCGGAAGGGTGTTGCCATCAATTTCGTCAC
CAACGAGGATGTGCGGATCCTCCGTGACATTGAGCGTAAGTTCCATGCCTGTTCTGATCGGGCGGATCGCGACCACTAAC
GCTTGCAGTGTACTATTCCACGCAGATCGACGAAATGCCCATGAACGTGGCCGATATCCTGTCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62