GenePrediction:GLEAN_6722 Details

Name: GLEAN_6722
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:503063..501214 (- strand)
Length: 1850
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:503063..501360 (- strand)
Length: 1704
Type: CDS
Source: GLEAN
Position: GCSC_156:501297..501214 (- strand)
Length: 84
>GLEAN_6722 class=GenePrediction position=GCSC_156:503063..501214 (- strand)
ATGGGCATCTTTTCGAGAAAGGAACGGGACCGGCCGCCGAAGACGGCTTCAGGTCCTGCCCCGCCCCTGACCACGTCCCA
TTCCAGTGGCTCTATCAACTCGGGCGGTTCGGCAAGCCTTAAGTCACCGCTCTCTTCAGCATCCTCCACACACCTCCCGA
CTCAGCCGTCTCACCACCATGGAGTATCTGGCGGTCGTGCAGTGAATCGTTCGTCCGCAGGCACAATGAACACCATCTCT
ACCTCCGCTTCTGGACCAGGCACTCCCATCACACAGTTCTCGCCCGTCCGTATGTCCAAAGCTGATCTTCCCCGTGGCCC
GGATCCCGCGCTGGACCCGGCCGGCTATCTGCGCAGCCTGCCGGCCGTGCGGGAACGGTCTCGCATCATCACCGACAAGG
CTCTGCGCGATGAGCTCACGCATTTTGACGTGGACATGTCCAAGTTCAGCGATGTTGTCACTTTTGTGGCCCAGATCATC
AAGCGTGACTACGACGCGCCATTTACCCCGTCTATTCCGCCTCACGGACGTTACCAGCACTTTGCTGTGGGCGGCCGTGA
CCGCATTGCCCTCCTCCTCGCCACGTGGCCCAACGATTCTGTCGACAGCACCGAACGTTGCCGCCGACTCATCGACCTCT
TCTTGGTCAGCGTGCTGCTGGATGCCGGCGCCGGCACGCAGTGGAAGTATACGAGCGTGGAAAACCGCCGGGTGTACCGC
CGGTCCGAGGGCATTGCCATTGCCAGCCTGGAGATGTTCAAGACCGGCCTCTTCTCCGGCAACCCGCAAAACAAGACCCA
GGTGGACAAGGATGGCCTGCAGACGCTGACCGTCGACATTCTCGCCAAAGGCTTGCAATCGCACAGCGGCAACGAGATGG
CCGGCATGGAAGGCCGTGCTGGCCTCTTGATGCGTCTAGGTGACGCGCTCGCCGCCAGCCCCGAGGTATTCGGGTCGGAC
GGCCGTCCTGGGCGGATAGTCGACTACCTGCTCGCACACCCGACGACGCAGGCATCATCCAAGCCAATCGTATCGGTAAA
CGTCCTGTGGACTCTGCTTATGGACAGCCTGGAGCCGATCTGGCCGGAGTCGCGGACAGCCATCAACGGGATCTCCCTGG
GCGATGCATGGCCGTGCAGCAGCATGCCACAGGCAAAGTCGGGAGCAGCAGAGTCGCACGGCTCGCCGCCAGGGTCGCTG
TCGTCAAGAACACCATCCACGCCCACATTCTCGCCCTTCCCAACGTCAGGGTCATCCAACTCGGCGTCGTCCAAATCGCC
CAACCGAGTTGCGGCATGGGAGTCGATTGTGCCGTTCCACAAGCTGACGCAGTGGCTGACATACTCGCTGATGCAGCCGA
TGCAGACGCTGCTCAAGATCCACTTCGCCGGGGCCGAGCTGCTGACGGGCTTGCCGGAATACCGCAACGGCGGTCTCTTT
GTCGACCTGGGCGTGCTAAACCTAAAGCCAGACGACATGGAGCGGGGACTGGCACATTATCGGGAGTTCTGCGAGCGAAC
GGGCCACAGCGGCATTGAGGTGGCGCCGATGTTCTGCACAGGCGACGACGTGGTGGTGGAATGGCGGGCCGTGACGGTTG
GGTTTCTGGACCGGCTGTGCAAGGAGGTGAACCGAACGTTGCGGACAGAGCTGCAGGGCTCCGAGCTGAGCCTGGCACAG
CTTCTGGAAGCAGGAAGTTGGAAGGTAAGCCGTCTCTGTTCTTTGTTTTCGTGCAACACGGAGCGCCTTTATGCTAACAT
GACCAGGGTGGACGTGAGATGGCCGAGATGTCACGGCCAAACACGAAAGAGCCACCGATCTTGATCGATTCTGATGGCAC
CGTGTTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62