GenePrediction:GLEAN_6723 Details

Name: GLEAN_6723
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:497636..496138 (- strand)
Length: 1499
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:497636..497574 (- strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_156:497497..497034 (- strand)
Length: 464
Type: CDS
Source: GLEAN
Position: GCSC_156:496960..496138 (- strand)
Length: 823
>GLEAN_6723 class=GenePrediction position=GCSC_156:497636..496138 (- strand)
ATGACCTCCCATGATGAGCGCATCAGCGAATTCTGTAGCATCACAGGCGTTTCGCCCCAGGAGGTGAGACGTTTTGTGTT
TCTGGCAGCTAACTCGTCGCCGGACAGCTCCAGGCAGCTAATTCGTCTCTCTGTCTCAGGCCGCTCATCACCTCGCAGCA
GCCGACTGGGACAACAACGTGGCCGTAGCAGCCTTCTTCCAGAGACTGGAGGCTGAAGAGGGACAGAACGAGCCCAGCGC
GACACCTGCGGCACCTGCACCAGCCGAGCCAGCATACACCGGACCGCGGACGTTGGATGGTCGGCCGGCGCCGTCGTCTA
TCATGCCGGGCGGCGGCAGCAGCAGCCAGTCGTCCAAAGCGTCGACGAAGAGAGCGCAAAAGAAAAAGGGCGTCATGACG
TTGAGCTCGCTCAAGGGAGGGGGAAGCGGCCACGACCACGAGGATGAGGACGAGGAAGAAGACGAGGAAGACGAGACGAC
CGGGCGGGGCGACCTGTTTGCCGGCGGCGAGAAGTCGGGTCTGGCCGTGCAGGACCCGAATGCGGGTGGCCATGCGAACG
ATGCCCAGAAAATGATCCGCGACATTCTGGCCAAGGCCAAAGCGTGAGTTTTCCGTCTCGGTCTGATCTGTTTTTACTTT
TGTTTGGTCAGCGTCTCCGGCTGACGCTCGCGGCAGAAACACGCCGAGAACGGCGCACAATACAGCCGACGGGCCGGCCG
AAGCGTCGTCCTCGCGGTCTTGGGGCTCTGGACAGACACTGGGCGGCGAAGGGCAAGAGTCCCGGTCGGTACCAGACTCG
TCCGGACGGTCGGCCACAGCGGCCGTCGCAGCAGCAGCAGCAGCAGCAGGGTCGGCGTCTCCTTCCGGCGCCGGTGCCGG
CGAAGCGGTCCAGGAACGCATGCTGCACATCTGGCAGGACGGCTTCAGCATCGACGACGGACCGCTGCACCGGTTTGATG
ACCCGGCCAACGCGGCCGATCTGCAGATGATCCGCCAGGGCCGGGCGCCGCTGCACCTCATGAACGTCCAGCTCGGCCAG
CCCGTCGATGTGAAGCTGCATCAGCACGAGGAGAAGTGGCACCAACCGCCCCGCGTCTACCGGCCCTTTTCCGGCGAGGG
TCGGCGGCTGGGCAGCCCCGTACCGGGAGCGGCTTCTGCACCGATCAGCACGGCCACCATCGCGACGACCACAACCACGG
CCACGACCACGACGGCTCAGTCGAGCACGGCTGCTCCGGCTGCCGACGCGTCACAGCCAACAGTGATGATCCGCGTGGCC
TTGCCGGACGGCACGCGGCTGCCGGCGCGGTTCAACACGACACAGACGATCGGAGACGTGTACGCGTTTGTGGAGCGGGC
ACTGCCGGCAGCGCAGACGGCCGGGCGGTCCTGGGTGCTGGCCACGTTCCCAAGCATGGAACACACGGACCGGAGCCTCG
TGCTGGGCGAGACGGCCGAGTTCAAGCGCGGCGGCGCGGCCATGGTGAAATGGGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62