GenePrediction:GLEAN_6725 Details

Name: GLEAN_6725
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:486413..480545 (- strand)
Length: 5869
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:486413..486301 (- strand)
Length: 113
Type: CDS
Source: GLEAN
Position: GCSC_156:486246..483108 (- strand)
Length: 3139
Type: CDS
Source: GLEAN
Position: GCSC_156:483053..482981 (- strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_156:482923..481811 (- strand)
Length: 1113
Type: CDS
Source: GLEAN
Position: GCSC_156:481740..480545 (- strand)
Length: 1196
>GLEAN_6725 class=GenePrediction position=GCSC_156:486413..480545 (- strand)
ATGGCTGTCGTCCTGGTTGCGGCATTGTCGATGCTGGTCCGTTGTGCCAACGGATTGGCATCGACCGATACCATCACATG
GGGCGGCGACAACTCGAGAACGGGCTACCAGACGTAGGTTGGCAGGATGCTGTGATGTGCGCGTTGGCTGCTTACTAACT
CTCGCAGGAACCACAACATGGACCCCGATGTTGTTGGCTCGGACGACTTCACCCAGCTCTTCAAGACGGCACTGCCTGGT
AACTATGGTGGCTACACCGAGCAGATCTTCTCTCAGCCATTGGTCTACACCCCGTCTGACGAGACCACCCAATACGTCTA
TTTTGCCACCACGCAGAACAACGTCTACAAGCTGAATGCGGTTACCGGAAAAATCGTCGCCTCGACGAACCTGGCTATTC
CTTTCCTGACTGCGGATCTGGATGGCTGTGTCGACATCAACCCGACTATTGGTGTCACTTCCACCGGCGTCATCGACCCG
GACACAGATACCTTGTACCTGACTTCCAAGACGTATGCCAACCAATCGGCCATCAACGTTGCCCAGGGTCGGCCCGCCGG
CCGCTACCATATTCACGCCCTCGATGTCCATGATCTCTCTGAACGCGCCAATTTCCCGATCGACCTGGAGGGCCTCGCTG
CTAACAACAACCCGGTCCGCACTTTCAATGGCGGCATCCAGCACCAGCGACCTGCCCTGCTGCACTCTGGCCAGTACATC
TACGCCGGTTTTGCCTCCCACTGTGTCCAGTATAACTTCACCGGCTGGCTCATGGGCTGGGACAAGACAACCGGCGCTAT
TGTCGAAAATTGGGCCACGGAGGGCGCCGGTGTACCAAACACAACCCCCGGTGGTGGTATCTGGATGTCTGGCGGTGGCC
TGGCCTCGGATGATAGCGGCTCCATGTTCTTCGGCACCGGAAACGGCTACGCATCGCAGCTGAGCACCATCCCTGTCCAG
GGCCGCAATCCGCCCACATCTCTCGAGGAGGCGGCTGTGCACATGACGATGAATGACGACGGCTCCCTGTCTATTATCGA
TTTCTTCATGCCCCAGGAGAAGCAAGCCCTCGATGGCGCGGACAAGGATCTAGGCACGTCTCCACTAGAGCTGCTACCGA
GCGAGTTCTCCTGCGGCGACATCACTCACATGGGTGTCATCACCGGCAAGAGCGGGAAAACATATTTCCTCAACCTGGAC
GACCTTGGCGGCTACCGCACTGGCACCGACGACGGCGACAATGTCATCCAGGTCTACCAGAATGAAAACTCAGTCTACGC
TGGTGCCGGTGTTTATCCTCTAGAGGGCGGCTACATCTACATCAACGTCATCAAGTATCCGACCCACGTGTTCAAATTCT
CGTGTGACAACGGCGTCCCTTCGTTCGTCAAGGTTGCCGACAGCCCCGAGAACAATGCGTACACGCTGGGTGTCAGCCAC
GGCACCGTGACATCTCTGGATGGCCAGGAGGGCACCGGCCTTCTGTGGACTTGCGACGTCCAGGGCAACAACCTGCGCAT
CTACAACGCCGTGCCTGACGGGGACCTTCTGACCGAAATCAAGTCCTTCTCCGTTCCCGGAACGACGAAGTTCACCCGTG
CTGTCTTTGGTGATGGCCGTGTTTACATGGGCACCACTCAGGGCTATGTCTATGGTTTCGGCGGTCCGGTCAACGAGGCG
CTGAACTGCACAACGCCCTCGTTCGGCTCGCTGGATATCGCCAGTGCCGCGAAGACGGCCACGGTTACCTGCACGGCGGT
CACCGGTACCAGCATCACAAAATTTGCTTTGAATAGTACTGACTTCTCGATTTCGAACCTGCCAACCGTGCCGAAGACGC
TGGCTGTTGGTGATACATTTACGTTCACGGCCTCGTTCCAGCCGACGGAAGTAGGCTTCCTCTCTGACAGTGTCCTGATC
ACTACCGACAACTCTGCGACTGGCTACACGAGTAAGACATCTGTTCGCCTGACTGGGACTGCAACCAGCAGCGGGCCGCT
GCTGGGTCTGTCTCCCAAGACGCTTACGTTCACAAACGTCGTCGTCGGAGCCAATCCCGGCGGTGTCACCGAGCCGGTGG
TCCTGAGCAACAATGGCAACTCTACCCTGACCATTACCGGCGTGCAGTACTCTCAAACCAGCGCAACGGGTCCGTTTGAG
CAGCCCTCGGGCAACGGCTCCGATATTGGCCCTTATAGTATTTCGGGCATTCCATCCACCATTGCAGCCAACGGCGGAAC
CACGATTGACATCAACTTTGATCCTACCACTGGCGGGAACTCCAGCCTCTTCATCGTCTTCGGCTCCGATGGTGGTAGCC
AGACGCTCTCTGTCAACGGAAATGCCGGCTCCGGTCCCGTCTGGCTGATGGAGTTCCAGACCCCTGATGGTTCGGGCTGG
GTTACTTACGAGAAGAACCAGAACTTTACCTTTGGCAACGTGACGGAGAACAATTCTCGGACGCTCAAGTTCCGGGTTAC
CAACAGTGGCAGTGCGGACGCGGTACCGCTGTCCATCACAGTGTCCAAGCCGCCTTTTGGCGTGTCAGGTATCATCGGCG
CCGTGAACGACGCGGATTTGGTTGAGGGCACGATTCTGAAGGCAGGCGAGAGCCAGACAGCCAGCCTCTACTGCTCTGTG
CCCAAGGAGCAGTGGAACAGCGACGCATACTGGGGTGCAGCCAACTGGACGATGAATACCAACGATCCCGACACGACCAA
GCAGTACATCCAGTTCTCCTGTCTCGCCGTCTCGGAACAGGCGCCGCCTCTACAGGCCGACGGGGACAGCGCCTACCGCT
ACCTGGGCTGCTACAAGGACAACAACCCGGACCGCCAGCTGACGACGCAGCTCTACGGCAACGACAGCAACACGATCGCG
ATGTGCATCGCCGCCTGCGCCGCGAGCGGCTACACGTACTGCGGGACGGAGTACCAACGCGAGTGCTGGGCCGGTAACAC
TATTCCCAGCCTCAAGGTCGACGAGGATGATTGCAACTACGCTTGCTCTGGCAACAATAACCAGATTTGTGGCGGAAATG
GCGTTGGTACCGACGCTGGCGGTTCCTTCATGTCCTTGTTCGCCCTGGATGGTGCGTCTACCATTCCTACTGGCTCCGGC
TCCAGCTCTGGTCCAGTTGTGAACTCCGGAATTGACGGTTATGTTAGCATTGGCTGCTACACAGAACCGTCCACGGCCCG
CGCCTTGGCCAACCAGCTTTCAACCACAAATGAGACGGTGGATGATTGCTTGAACCTTGCTGCGGCGTCCAACTACGTAT
ATGCCGGTCTCGAGTACGGTGGCGAGGTGAGTTGCACAACGCTCTTCCTATGCACTTGGGATACCTACTGACTGAATCAG
TGCTGGGTTGGCAACAGCCTCAATTCCGGCGCGAACAGCACGATTCTAGCGAGCTGCAGCATGACCTGCAATGGTAAGTC
TGGCTGCGCCTCGGCTTTTCTTTCCAGCCATGTGCTAACACTCTGCGCAGGCAACTCTTCAGAATACTGTGGTGGTCCGT
CTCTTCTGAACATCTACAGGCGCAACAGCACTACCTTGCCGACTAGCACATCTTCGGCGTCACCGTCTTTTGCCACCGGT
CCGGTCACGAACCCTGGTGAAGATGGCTACACGTTTCTTGGCTGCTACCAGGAGCCTTCGAACTCGCGTGCCCTCTCTAA
TCAGCTGACGGTCACAAACCAGACGGTGGGGGTGTGTCTGGCACTGGCAGCCGCAAAGGGATACACGTATGCAGGTCTGG
AGTACGGTGGAGAGTGCTGGTGTGACAACACGCTCAGTCCCAACGCCACGTTGGAATCGACGTCGGCATGCACTATGACC
TGCAACGGCAACTCTACCGAGTACTGTGGCGGCTCGTCGTTGCTCGATGTCTACAAGACGAATTCGACGACTGCTGCTAC
AACATTGGGGACGCCAACCCAGGTGGCCGTGGCTACGACTCCAGCTTCAACTGGCCCCATCATCAATCCCGGTCTGAAAG
GATACGCGTTCCTGGGCTGCTACCACGAGCCGTCAGGCTCGCGTGCCTTCTCGAACCAGTTGACGGTGACAAATGAGACC
GTAGCTAACTGTCTGGACCTGGCTTACTCAGCTGGATACATCTACGCCGGTCTGGAGTATGGCGGCGAGTGCTGGTGCGG
CAACTCGATCAGCGTGAACGCAACACTGGAGGCATCCTCGGCTTGCGCAATGACATGCAATGGCAACTCTAGCGAATATT
GTGGCGGCTCGTCGCTTCTTGAAGTCTACAAAACCAACAAGATGGCCACGCTGACAACGGCGACAACGGCGACAACGGCG
ACTACAAGCAAGGCAACGGCTGCCGCAATAACAGGCCCAGTCATCAACCCTGGCCTCGACGGCTACAGTTTCCTCGGCTG
TTACAAGGAGCCCTCCACCAGCCGGGCTTTCTCCCAACAGCTGACAGTCACCAATGAGACGGTCGCCAATTGCCTGCAGC
TGGCTGCCGCTGCCGGTTACACTTATGCTGGCTTGGAGTATGGTGGTGAGTGCTGGTGTGGCAACACAATCAGCCCCAAC
GCGACTCTGCAGGCTTCGTCGGCTTGCACCATGACGTGCAATGGTAAGAACTTGATACTCCACTCTTGTGATTTTGTCGC
TGCAAATTACGCCCTTGCCTAACATCATGACAGGCAACACGACGGAGTACTGCGGTGGCAGTAGCTTGTTGGACGTGTAC
GAGCTAAGCACAGCAACAACGAGTCCATTAACAGCGGCAACCCCGACCAGTGCCGCTTCCGGAAAGGTAGCAGGGCCGCT
GGCTATTGTCGCTTCCGCAACGACGCCCAGCACGGCGGCGACCATTGGTAGCAACAGCACGGCGGCGACCATCGGCAGCA
ACAGCACGACTGCAGCTGCGGCGACTCTGCCGTCGGCAACCAGTCCTTCCACAAGTGTCTCCTCGACGGCTACGACGTCG
GACACAACCGCTGCCTCCAACAGCACGATCGCAACCACGTCTTCCTTGACTGCCTTGAGCGCTTCCACCTCGGGAAAGAA
AAGTGCTAATACCACCGTTGCTACCGCGACGACCTTGTCGTCTGTCAGTGCTACGACGCTGATCACGACAACATCTGCCA
ATAGCACACTTTCTCGCACGGCGCCGAATATCGTTAGCTCTTCGAGTTCGAGCTCGACATCCAGTTCGAGTTCAATTTTG
AGTTCAAGCTCGACATCCAGCTTGATTTCTAGCTCGACTTTGAACTCGACTTCAAGCTCAACCTCTAGCTTGAGTTCAAG
TCCAGGTTCTAGCTCAACTCCCAGCTCGACTTTCAGTTCGACTTTCAGCTCGACGTCTTCTGGCAGAACAAGCTCTAGCT
CCCCCAGTTCTTCCGGTTCCCCTAGTACCCCCAGCTCCCCTAGTGCCTTCAACTCCTCCAGCTCCTCCACTTCTGTGAGC
TCTTCAAGCGCTTCAACAAGTTCAACGCCGACATCTTCCTCGGCAAATGTCTCTCCGACGGTGGAGCTGCCAGAAGCCAA
GACGCTGGTGGGCAACTACTCGTATGTCGGCTGCTACTCGGAGCCGAAGATCGGCTACGCCTTGTCGTCCAATAAGACCA
AAAGCATCAACATGACGCAAGAAAACTGCGCCGACTTCTGCGGCGGCTACTCGTACATCCTCTTCGGCGTCGAGAACGCA
GACGGCTGCTACTGCGGCAACAGCCTGAGCAACAGCAGCATCCAGGTCAACGAGACCAAGTGCTCCAGCATCTGTTCTGG
CGACGATCGTGAGCTGTGTGGCGGGAGCGCCGTGCTCAACGTCTGGTCGCTCAACGTGACGTCGAGCTTGACGCTTGCAT
CTGCTTCAACGTCCCCGACGGCAGCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62