GenePrediction:GLEAN_6728 Details

Name: GLEAN_6728
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:457929..454863 (- strand)
Length: 3067
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:457929..455131 (- strand)
Length: 2799
Type: CDS
Source: GLEAN
Position: GCSC_156:455036..454863 (- strand)
Length: 174
>GLEAN_6728 class=GenePrediction position=GCSC_156:457929..454863 (- strand)
ATGATGAACCTTCGGTCGCTGCTCAACTCAAACGACGATGGCACGGGCAATCCGCCTCGAAACCGATCTCCACCACCACC
ACCACCACAACAACAGCAACAGCAACAGCAGCAGCACTTGCCACAACAGGGCCCGCCGTCGACGCCGGTGCAGACAGGCC
CGTCGCCGTTTCGCGATTACAGCAACTCCATACACTCCATACACGCATCGCCCGGAAGGGCATTGTCTTCGCACGAATAC
GCCGCCGCCAACCTGCACACGCCCTCGGCCGTCTACGCGTCACCCTCGGCGACACCCGGTGGCGGTGGCCCCGGACCCTA
CGGCGCTCGGCCGGTGCCACCACCACTGCAGACGCTCAACACCTCGGACCTGCACTCGCCCAGCAGCGCCAGCCTCTCGG
GCCCTTCGCCCTATCGCCATACGCCCAGCAGCAGCTCGGTCAGCAGCGCGTATCCCTTCCCACCCAGCCAGCCGCCGTCA
GCTGTCAGCCCTGTGCAGCACCACCAACAGTATCCGCCCGGCGCAAATGCCTTTCCGCCGTCGTCGCGTGACTATCCCCA
GTCGGCGGGCCCGGTGGGCTTACCAGGCCCCCCAGGCACCAACGCGTACATGCAGGGGGGCCAGCCACCGATGCCACAAA
CCCCCCCTATCGGTCCGTCCGGCGGTCAGCACGCCTACATCCACCAGCGGTCGCAGTCCACTCATTCCACTCCCACCCCG
ACCTCTGCCCAGAGCCAGCACCCTCCTCATCCGCCACCCGCTGCACAACAGCAGCAATTTGGCGCGCCCTACGGCCAGCC
CAGCCCAGTCGTCGCCCAACGTCCCCCATTGCCGCAACAGTATCAGCAGCAGCCTCCCACGCCACTCGGACCGCCTTTGT
CTGCCACACAACAAAGGGCGCCGTCCGCTGGGCCAGGCTACCCCCAGCAGCAGCAGCTACAACAACAACAACAACAACAA
CAACAACAACAACAACAACAACAACAACAACAACATCAGCCACATCAACAACAACCACCACAACAACAGCATCAGCAACA
GCAGCCATTACCTGCGAGTCCGCTCCAGCAGCGCATGTCGTCAGCGTCATACCTCCCCTACCAGTCGCCTCAACCGACCA
ACCAACATCTGCCCCCCCACGTATCACCTCGAGTATCACATCCTTCCCCGGCCCCACATCACATGCCACTGGATCGTCCG
TCTTCGTTTGCAAGCCAAGCCACGTACGGCCAGATCTCAGTCGACACGCGTCGCAGATCGCTGTCGCACAGTGATCGCGG
ACGCAGTGTTAGCGTCAGCCCCAAAACTCGTCCAAACGGTGTGCCCCCTGGGTACTTTGAAAGACGCGAACGACAGGCCA
GCTTTGACGCAAGCCAGCCCCAGCTGCCGCAGCAGTCACGGCCATCACCCCTTGCACAGCCGGCTCCGACACCAGCCCCG
ACCCCGGCACATGCACCGACTCCCACACCTACACCCATCCGAGCACAACCTCCGGCACACCCACTCGCATTACCGGGACC
GGCGCCCGCATCGTCGGCAATGGACGTGGACCGCCCCCACAACGGCCAGACGGGCAAGCGGAAGATGGACGAGCGCGATC
TGAACCCGGACGAGCTGGAGAGGAAAGATGTGCGGCGCATGGCACCCTTTGAGAAGGGCTCCAACGGCGTTCCATCACAT
AACCAGACTACTACAGCACAAGCAACAGCCCCGAAAGCAGCAGCGGCTGTGCGAAAGGTGGCTAAGAAACAGCGGTACAA
GCAGCTGCCGGTGTGGGCGCAGCGATTTGACGGTGGCCGACTGCACGTGCCTAACTTTATCGTGCACAAGCCGGGAATGT
CGCGCGCCAACGCTCACAGCAAGTCAGAGAACGCGTCGTCCAGCTCGCACGCCAGTCGCCACACGTCGCGGCACGCGTCT
CCAGAAGCATCACGGTCGTCGATGACAGCAGCGCCCGATCTGCCGGCTGCAGCAGCCGCAGCCGAACCAGCGGCAACAGC
CCCGACGGCGGTTTACGACGCGCGACTCGGGCTGCTGGGTCCGTGGGAGGAGTCGATCACGGGCGAGAAGCCGAACGAGG
AGATATCGCAAAAAGTGGCCAACTTCCTCTTCTTCAACGTGGTGAACAACCCGAGCATGGCCGAGATTCAGGGACTGGGG
GTGCAGTTTGAGATCGAGGCGAAGCTGGGGACGCTGATTAGCAAGGATACGAACGAGCGGGTGGCGTTTCCAGTGGCGTC
CGAGTGCCTGCTGCAGGACACAGGGCGGGTGACGTTTCGGAGCAGCATGACGGAGGCGCAGCACCGGACGTACAACGAGT
ACCTCAACCATCTGGTGCAGGAGACGAACGCCAGCCACCGGCCGAACAGCACGACGAGCACGGCGGTCAAGGCGCGCGTG
CCGCTGGTGTACAAGCACCGGCGCGAGATCGACCGGTTCTACGAGCTGCCGCTGGAACTGCAGGAGCGGCTGCCGGCCTG
TGTGCGCAATCTGCTGCCGCGGCGTCATGGCGTGCGCGTGCGCATCACGTACGACAAGGTGACGCAGCAGGTGCTGGCCA
AGATTGTCAAGGCCCGGATCGGCGACCTCAACATCTACTTTCCCGACTCACCGCTGGACTGCCGCCTCAGCGTCAACCTG
GAGATGGCCTGGGAGGGCCCGGTCGAGGAGGTCGAGCGGCTGGCGGCGGCCAGCGGTCGTGAGCGCCAGCCGGACCGCGA
GAAAGATCGGCTCAGCTACACCCACAGTCACTACCAGATCGATCTGACCCAGGTGACGTACAAGGTGCCGGGACCGAATG
TGAGCTTATTTTTTTTTCTTATTTTTTTTTCTTTCTTTCTTTCTTTCTTCTTTCTTTTTTCCGCCATATCTCATACCCCC
GCTTACCCTCCAGAAAATGGAACGCGAGGAAAAGGAACACGAGCTCGAGGTCGAACTCGCTCCCCAGATGGTCATCGAAC
AAGGCCGACGGGCCGCCAACATGGAACCCCATGCCTACCGCGAGCTGGTCGACGGACTCCTCGATAACATCCGCATCCTG
ACGCGGCCACTCAAGAAAATAAAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62