GenePrediction:GLEAN_6729 Details

Name: GLEAN_6729
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:454532..452881 (- strand)
Length: 1652
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:454532..454302 (- strand)
Length: 231
Type: CDS
Source: GLEAN
Position: GCSC_156:453899..453849 (- strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_156:453777..452881 (- strand)
Length: 897
>GLEAN_6729 class=GenePrediction position=GCSC_156:454532..452881 (- strand)
ATGAGTCCATCTTGCGTGCTGATCAGTGACAACCTGTGTCTGTTGCGATTCTTCGTACGGACCGACGTGTTTGGCAACTC
TCGAATCGCCTTTGTCGTCTTGGCCAAGCACGCCATTTTGGCCGCTTTCGAGGCCGTTCCGCAATACGAGATGCTCTGGA
TGTGGTATCTGGCCTTTCCGACTGTTCCGCCAGTCTTTCCGACAAACGCCCCGCAACCCCGATTGGGAAAGGTAAGATAG
CTGCAAGCTGGCAGCAACGGCTTGCCGAAAGCTGCTCTCGGAAACGGGCAACAGCAACGAACCTCTACCAACATCCCGCC
TTCCTCCCAACCAAACTGACGCCATCCCCGCTACCGAAGCTGCCTGCCATGACGTCCTCCAAGACTCGTCTGTTCTGGAG
CGCGGCCGTTGCGTGCCTTTGCCTGGCGATCCCGCCGCTCCTTCTCCGTTCGGCTGGCCTGCCGGTGGCGCCTTCTTCGC
TCTCGGTTCGTAATATCATGTCATTCGACTGCTATATCTTCCATGACCCCCCTCTCCATTTCCCTCTCCCGCTCTTCCTC
AATTGTACTCCTCGCAGCTTCTCAGCCAAACATCGCCAGCTCTCATTAACCGCTAACCGTGCTGCTGCAATAGAAACTAT
TTCCATCATCCACCATGGGCATCAAGAACGTAGCCGTCGCCGGAGTACGTTGTTGTCCTCTCTTGGCTTCTCCTGCCCGA
GATACAACCACTGAGCATAACTAATATACACCCAGGGAACTGGCAACATTGGAACGCCAATTGTCGAAGAGTTCGTTAAG
GCTGGCTTCACCGTCACGCTTCTCAGCCGCGACTCCAAGCAGCCTCTCCCCGAGGGCGTCAAGGCCATCAAGGCTGTCGA
CTACAGCTCTGTCGACTCGCTCAAGGCAGCCCTGAACGGACAAGACGCCGTTGTGTCCACTCTCGGCTCGCTAGCCTTAG
GCAACCAGAGCCCGCTTATCGACGCTGCTATTGCCGTCGGTGTGAAGCGCTTCATCCCGTCCGAGTTCGGCATCAACACT
CGCAAGGCACGTGACACGCCCATTGGCAAGATCATTGCCGCCAAGGTTAGCACGGTCGATTACCTCATCAAGAAGGCAGA
CGCGTCCAAGGGCGTCTTCACCTGGACCGGCATCGCCACTGGCCTGTTCTTCGACTGGGGTCTGGACCACGGCTTCGGCG
GCTTCGACGCCAAGACCAAGGCTGCCTCGATTTATGATTCGGGCAACGAGAAGTCGCAGTCGTCCAACGTGCACTTTGTC
GGCCGCGCCGTCGCTGCCGTCCTGAAGCAGGCGGGCGAGCACTTTGGCACTGCCGGCGACAAGACAGCCAACCAGTACAT
TGAGGTTGCGTCCTTCTCTCCATCGCAAAACGACGTGCTGAAGATTGTCGAGGCCGAGACCGGCGCCAAGTGGACCATCA
CGCACACCAAGACGGCGGACCTGCAGAAGCTGGGCGAGGAAAAGCTCACAAAGGGAGACTTTTCCGCATTCGGCGAGCTG
CTGCTCGTGTGGCAGTTCAAGGATGGCGCTGGACACGCGCCTGACCCCAAGACGAGCGGCAATGCGCTATTGGGACTGGA
CGGTGACGATCTGAAGGAAACGCTCAAGAGCTGGATTGCACGATCCCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62