GenePrediction:GLEAN_672 Details

Name: GLEAN_672
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1341172..1345118 (+ strand)
Length: 3947
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1341172..1341277 (+ strand)
Length: 106
Type: CDS
Source: GLEAN
Position: GCSC_97:1341346..1342635 (+ strand)
Length: 1290
Type: CDS
Source: GLEAN
Position: GCSC_97:1342739..1344718 (+ strand)
Length: 1980
Type: CDS
Source: GLEAN
Position: GCSC_97:1344771..1344904 (+ strand)
Length: 134
Type: CDS
Source: GLEAN
Position: GCSC_97:1344972..1345118 (+ strand)
Length: 147
>GLEAN_672 class=GenePrediction position=GCSC_97:1341172..1345118 (+ strand)
ATGACTTCCGTGGACGAGTATCTTGACAACGCCCTCGATGGTGACGACATATTCCCTTGCAAGGGATGTGGTGAAATCCT
GGAGGAAGGCAAAGCGTTCGAGCTTGGTACGTGTTCTCGTGTCCTCATGAATTCGAATTGGATGCCAGACCCACTGACAG
CTGTGAAATGACAGCCGGCCACCGATGGCATCTCAACTGCTTTCGCTGCAACACCTGCGGCACGCTGCTCGACTCTGACG
CGAATCTCCTCCTCCTTGGCGACGGCTCCCTCATCTGCAACAACTGCACCTACAGCTGTAATGCTTGTGGCAACAAGATA
GAAGACCTTGCCATCCTGACTGGAGACCAAGCTTTTTGCGCCACCTGTTTTCGCTGCCGAAACTGCAAGCGCAAGATCGA
GAATCTCCGTTATGCACGCACATCCCAGGGTATCTTCTGCATGAGCTGTCACGAATCGCTCATGGCCCGTCGCAGAAAAA
AGCACAAGGCTGCTGCACAGGCCAAAGCTCGAGAAAAAGAAGCGCTGATCACCGAGAAGTCCCTACCTGCACTCCCGCCA
GGTGGACCCGAGACCCCCACCGAGGCGTCTCCTCGCCCACCGCGTGTCCCCTACAACAGCACGTTGAGACAAGAGAGGTC
GCCCGAACGGTCGGCATCAGATGGAAAAGATGCTGCCGGCAGAGGTCCTGGCCCATACGCCCTATCGCCGCCAACCTACC
GCAAGAACCGCAACTCGTCTATTCTTCAGAACAATGTCGACGTCAACTCCAGCGATGGTGACAGCTTTTTCATCCCAGTC
GCTCTGGACCCGAGCCCCGCCCCATCTGCGCCCCGATCGATTTCAGACAACACCGTCGACCTCGCCGACCCCAACGGAAA
GACGCGAGACCGGGAATACTTCACACCTGGTCCGGGTGACAGGAGAGAGTCGCAGGCCTCGACGCCGCACATCGCTTTCC
AAGAAAGGAACCGGACTTCTACCCCCTCCGAGTATGATAGCAGCAGCACCACGGCTAAAGACCTACTGGCTCGACAGTCT
TCCAAGTCATCCAGGTCAGAGAAGGGCTTGGCTGCGAGCTCTATGAGCGCTGGAGAAGAGCTCAAAAAGCCGTCCAACGG
ACGTGGAGACGAATTCAAGCTGCAAGATGCTCCTAAAAGTAAGAGGGCTATAGCCCAGGCCCGAAACAACACTCAATCCA
CCGTCACATTTGAAAGTGGCACGCCACCAGCACGGCGGGAGAGGCAAGCTACTATGTCGTCGTCGTCCTCGACGCCTACC
TCAAGCACGGGGCGACAGTCGTTGCAGGACACACGCCGGCAACCAAGGCAGGAAGACGATGTCGAGACGTCGTCACCAGA
GTCATCTGGCTTGGTGACACCCAACAGTCGAGCAAACGTGGGCGACCAGCAAGTTCGGGCAGGCCCAATTCCTCGCAAGG
AACTTCCCACTTCGACGCGCACTGGTAAGAACCCCCCTCCCCCAAAGATTGACGTGCCTTTGTATTCCTCATGAGTATTC
TGGACTTGAGAGATTTTATATCTGATGGAAGCTAACATGGGTGACAGCCAACGGGAAGCCCGTTTTGAGCCCCCTCGGCG
ATCTTATCTCACCTGCAACGGCGCTACCCCCACCCGTGCGTCCAGGGCTTACGGAGACGAAGTTAAGTGACACGTATATG
CAGCCTCGCGCTCCGCCACAGCCTCCGACAGCAGCCCCGCCCCACCCAGCTGTGAAAGACTCCGGCGCCAGTAATGCTGT
TGCTGCGAACGGTGACGCGACACCTGCATCTCCTCCTACTGGACCGTCGCCCAAGCTGCCAAGATGGAGCGCCGGCGGCG
ACTTTAGCTTGGACGAGGACATGGCTCGCATTCTCGGCACGGACGAGTCCTCCTCGTCTATTCTGCGTCGCGTTTCCAAC
GCCGTGCGCCATGGCCGAAACAGCAGCACGGAATCGAGTAGTGTCAACCATCACAATGGCCGCCCGGGCCACAGCCGAAG
CCTCAGCGAGACCACACGGGCTACATCGTCTCCTCGGTGGCCGAAGACGCCCATTACGGAGAACGTTATTGTGGATGTTC
ATGCGCACGACATTAGCAGCCCGATTTCTGTTTCTGGCGCTGCTCACGATGACCCAGCATTCCTCAAGCGCCAACTGCGA
ACATCCGAGCAACGCGTTGCTGAGCTCGAGCGCCAGTTTGGTGCAGAAAAGGATCTGAAGTCTCTTAACAAGAAGCTGAT
GGAGAAGCGGCGCACAGTCTCCGTGCTGGACACGCAAGCGGAGATCATGATTCGCCAGTTGGAAGTACTGGCCGGTTACG
TTGAACGGGCCAAGGCAACGAAGCAGCCGATCGATGCCAAGGAGTTGGAGGACTCTGCCATCAAAGACTTTGTGCAAAAG
CTTGATGAGCTGCAGAAGAATATGGCGGCTGAGATCGAGCAGCTGCATACAGAGCGTGATGAGCTGGTGGATGAGAAGAA
CCAAGCCGTTGCCGACCGTGATCGCGCACTGCTCGAGTTTGAGCAGCTGTCGTCCAAGAATGCCCAGCTGGCCGACATGA
ACAACGATCTCACCCACCAGATCCAGGAACGATTCAAGTCGCAGATCACATCTGAGCAGATCAAGTCCCCCAGCGGCTTG
GGCATTTACCAAGCTAACAAGGGGCCGTCCATTTCGTCGGTGAATCTGGAAACTGCTAGCGTCCAGACGTCGACTGGTGC
AACGCTGATCGGGACAGACGTTGATGAGACAGTCGTTGAAAACGGTCCAACAGTTGTAAATATGCGCAAGGGCCAGGTTC
GCAAATTTAACTGGAAGAAGGGATCCAAGACCGTGGCGCAAAATTTCAGCAAAGGTGTCAACCGGGCTGTCGGAGCCTTC
CAAAACGATCGAGATCGACCTGGCTACCCGGGTTTGTCTGGCGATAGCATTGGCCTGCCTTACAACATGACGGTGGCGTC
GGTTGATTCGCCTCAAGCCTTTGGCCAGCCTTTGCAGCAGGCCAACCGGATGCCGACTGAGTTTGGTCCTCCCGGCAGCC
GTATGGTCAGCGCAGCGACGGGGCCCACTGTGGTTGTCACCGCTGGTCCCAATAACGGTGCATATGTTGGGGGCCCGAAC
GGTCCGAACGGTCCGAACGGTGCGGCTAGTTTTGCTTTCTTCAAGAAATCTGGAATGCCCAAATCTGGCACGTCTACAAC
TTTGGGGAGCTCGGAAGTTGTGGTGGCGGAGGCGCCGAACGTTTTGTTCGGATCTGATCTGGTGGAGCGGACGGAGTTCG
AGCGACGACACATCCCGAGCGTAGTAACGCGATGCATCGAAGAAGTGGAGCTTCGTGGAATGGATGTTGAAGGCATCTAC
CGCAAGACGGGCGGCAACTCGCAGGTCAAGGCAATTCGTGAGGGATTCGAAAAGCAGGACGACTTTGACATTTCCGATCC
GGACCTGGACATCACGGCAGTGACAAGTGTGTTGAAGCAGTACTTCCGAAAGCTGCCGACTCCGCTGCTCACGTACGATG
TGTATGATCGCATCTTAGAGTCTAATGGTGCGTATTGTCTCATCCGTCCTCTATCATACTCCAGCTAACGATTGTGCAGG
GGTCGCGGACACTGATGAGCGTTGTGCTCACCTTCGAAAGACGATCAACATGCTGCCGCAGAAGCACCGCGACTGCCTTG
AGTTCCTGATGTTCCATCTGGCACGCGTGGCCAACCGAGAGCGGGAGAATCTGGTAGGTTTCGTCGTGGATTGATACGCT
GCCTCAATAGCCAGAGCTGGAGCTAACAAAATTCCTTTAGATGTCGCCAAAGAATTTGGCAGTGGTGTTTGCTCCGACCA
TCATGCGCGACCACAGCCTGGACAGAGAGATGACCGACATGCACTCCAAGAACGTGGCGGTGCAGTTTGTTATCGAGAAC
AGCAACATCATCTTCTCCGAGGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62