GenePrediction:GLEAN_6730 Details

Name: GLEAN_6730
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:451451..448042 (- strand)
Length: 3410
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:451451..451376 (- strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_156:451316..450513 (- strand)
Length: 804
Type: CDS
Source: GLEAN
Position: GCSC_156:450461..450018 (- strand)
Length: 444
Type: CDS
Source: GLEAN
Position: GCSC_156:449963..449844 (- strand)
Length: 120
Type: CDS
Source: GLEAN
Position: GCSC_156:449223..448407 (- strand)
Length: 817
Type: CDS
Source: GLEAN
Position: GCSC_156:448330..448042 (- strand)
Length: 289
>GLEAN_6730 class=GenePrediction position=GCSC_156:451451..448042 (- strand)
ATGGCATCTACAGCAGACGAGAGCAGCATCGACAGCGGACAGGGGCCTGAGCCGGCTACTGCTACTGATACATCCCGTAT
GAAGCCTTACACGTTGATGTGTTATCGTTTACTCGCAATTTCTAATGACAAGCAGTACAACTTATCAAAGGCATGCCTCT
GCCCTCAGAGATCGTCGCCATGATTCTCAAGCTCCTCACACCAGTAGATCTCGCCGCCTTGTCGTGTGTGTGCCGGGCAC
TGCATCTCCATGCAATGTCCGACCGCCTGTGGCGTATCCTTGTGCAGAAGAACGTACCAGGAATGGAGGTGACCTCACCA
GGACCCTTCGGCAGCTTCCGCGAGCTTTACATTGCCCACTTTCCCTACTGGTTCATTCCACAGAAGAAGGTCTGGATCGG
CGGCGACTACATAGTGGGTACTATACTCATTGCTCGCTATGAGCCCGAAAAAGCACGCATTGAAGGCTACCAGCTGTTGT
CCAGACCCTGGATCAGTACCCCCGAGCCAGGGAACGCCGGTGCGTTTTCCAATCTGTACGACCCGACGAATTTAGAGCTG
TTTGTCGAGCAGCCGAAGATCATGTTGGACGCCAATGATCGCCCCCCCCGGCGTGGAAGTCTCAGCAATATCCCCATGGC
GGTCCAGGGCTGGTCCGATCCCGCAGGTAATGCAGGCCTGTTACGCAGAAAACTCATCTTCGCCACACCCATGACTGTTG
AAGATGAGCTGGGCTTTAGTGGCAGCCCCTGCATGGCGCCGCCATTCAACATCCCAGCACCACACCGGGTCTTGTGTGAG
CAGCAACTCATTGATGGACTCCGCAGGGAAAACACGTCAATGTACAATGATAGCGACGACGACGAAGACGACTACGGCTT
AGAAGTCAGCTGCCGGCCGTTCCGGCGTGCCCATCTCAGCAAACAAGCCTTTCACATTCGTACGTGGGTAGACCCAACTG
ACATACAACCTAACTTTCCGGTGCAGCCAGCGCAGTACCACCGCTTTATCAACAATGTGGACACGTATGCTACCATCGAA
TCGGTGTATTACACTCCCACGGCCGACAAGCCGTTCCAGGGCATCTTCATCGCGGACTACGGCGGGCACGGCTACGAGCT
TGTACTAATTCACCAGCCCGACGATCACGTCAAATCGATTGATGAAGATACCGTCGTGGATCGACAGCTCGACGGCGAGA
CAGAGGCTGAGTACAAAGAGCGACGCAACGCCCGCATTTACCGCGGTAGCCTAGAGGCCATCAAGCTGACCGGCGACATC
AACGTGCCTCGCGGAGAGATCACCTTCGTAGCCAACGATCTCAGCGCGACGGACAATAGCGGCACCGACATTGGTATTGC
AGAAGCTGTAGTACCCGCGGGTGTGCGAAGGATCTGCTGTAAGGGCCAAATCGCTGATCACGGATACAAAAACCGTAAGC
AGTCTCGAACGGGGAAGAGAGAGTTGAGAACAAGCTGACAACCGGCAGATCGGTTCATAGACTGTCGCCTGTTTCCGATC
ACGCCCGACTGTCTGGCGCTGTACTGGATTCCCTTCAACCACGTCATGTTTTACAAACGAGTGGATATTGATGCCTTCAC
TAGGCCCGGTGTGAGGAGCGCTAATTAGGGTTCTGCTCAGATACCCATCTGAACGAGCTGCAGCGACACTGGTCTATTGA
AAGGGAGGCGTATATTTCATGTCAGACGGAGGGATTCTGATCGGCGTTGGATGGGACAGCATGGATACACCTTGGGCAGC
ATTTCTTTTCCGGGGCAAGATAATGGCAACTGGCAAGTCTAGATGCTTTGTACGCATTCGTAAGCAGGTCTTTTATCGCA
AAGCCAAAAACCGATACATGAATAAAAGTAGTGTACTTTGTAATATTGGTCGCGGGTCCCTCCTTCCATGTTAGATTGGA
GTAGGACAGCGGCAGCCCTTTCTCCCGGCGCAATTGGTTTTGGAAATGTGAGATGTGAACCTTTTGCTTCTTTTCCAACC
AACTGGTCGTGAGATTGTGCACTGGCGTCTTGTCCAAGTCGTACGGATGGCGAGTAAGGCTCGTTGGGTCCACTGGTGGG
TTGCTCCATGACGTCAATGACTTTTGGCCAACTTCGGCGATCGTTCTTTTCTCCTTTCTACTCTCCCCTTTCCCTTCTTT
TCCCTCGTTTCATTGTTCGGCTTTTTGCGCCTTCTTGCACCATACACTCTTCTCGATCCCCTCGACAGCCATGGCCGCCT
CCACGGGTGCCGACGGCTTTCTGCTGCGCGTCACCGCCGGCACGTCGTACGACCGGGCGACGCACGTCGAGGTGCCGGTA
AACGAGCCGCGGCCGGTGCGGCTGCAGGGTGCCTCAGCCGATATTTCTCTCTGCGTGCGCATCCACGGCTACGACCGGGG
ACTGCCGCGGGCGTCACCGCCGACGAGCGCGTACTTTGCAGCGGCGCCACACGCAGCCAACGGGGACACGTACAGCATCG
GGTTGGCCTTTACGCCGAGGGCTGGCGAAGCGGGCGAAAACGAGAAAGATGCAAAAGACGGAAAAGACGGAAAAACGGCC
GGCATCTCCGGCCACGACCTCCTCTGGGGCAACGACTTTGACCACTCGATCCGCGACCACCTGCCGCCCGGCTTCAACAC
GGCCCTGCGCATTATGCGCTGGTGGATCGACCCCGGCATTGACGGCGACGCCTATGCCGACAAGCCATACCTGTACGGAC
CCGCACTCAGCTCATTCAACCGCGTGCACGTGGGCGGTCCAGACGACGTGCACGACCCGCACGACGATCGCGGCTTCTGG
TTCGAGGAGGGCGGCGACGCTGCCGGCCTGGCCATGCGCGCGGCTGCCGGATGTCCCCCCGACGATCCGGCCGCCCGCCA
GAAGTGGGCGCTCACCGATGCGGCCAAGTCCAGCTGGGTCTGGGCGCATGACCAGACGTACGGGCTCGACTTCTTCAACG
CCTACCTCGATTTCCGCGAACTCGCCCTGCGGCTGCCTGGGTTCCATCTGCCCGTGATGAAATACTGGGACGGCCAGAGT
CTCCGGTGGGATCTTTGTTTTTTATTCTTCTTATTCTCTCTTTTATTTTTATTTTTCGGACTCCCTTAACTGACAACCCA
GGTACGTCTTGCGCAACCGCACTACCGAGGAGGTCTACCTGGTGGTGGAGATCACGCTTTTGCGCCAGGAGGACGTCGAC
GAGGACGGCACCGTCAGTCCTGAAGTCTTGGCCAAACAGCACTCCAAGACAGCGCCCAAGAGAGATGACGGAACAAGTGC
ATCTTCGGACGAGACCGCCTTTGACGAAGATAAAGCCCTGGACGAGGCAAGGAGAAAGCTGTCTGTCGGAAAAGGACACG
AGAACGAAACGGAGAGTGCGGTCGAAACCAGTCTAGACGATGTGGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62