GenePrediction:GLEAN_6731 Details

Name: GLEAN_6731
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:444949..443835 (- strand)
Length: 1115
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:444949..444908 (- strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_156:444851..443835 (- strand)
Length: 1017
>GLEAN_6731 class=GenePrediction position=GCSC_156:444949..443835 (- strand)
ATGGCCACCAAGACAACCTACGCCGACCGGCCCATTCCAAAGGTATGCTTTTTCTGTCTGTCTGCCGTTTGACTGTTCCA
CCTCCTCTGACACGCTAGATCTCGCTCCGCGACTTTGACGCCCGCATCGACGAGATCACGGCCGAGCTGTGCGACGCCTC
CGAGAATGTCGGCTTCTTTGCCCTCGTCGACCACGGCATCCCGGCCGCCGAGATCGACGCCATCTTTGCCCGCTCGGCCG
CCTTCTTCGCCCTGCCCGACGAGGTCAAGGCCACGGTTCCATGGAGCCCGCTCAACGTCGGCTGGGAGAAGATGAACCAG
ATCCGACCGAGCACCGGGGCTCCCGACACCAAAGAGTCGTACCAGCTGCAGTTTGGCGAGAACATGGACCACGGTGGCAC
CGCACCGGGAGGAAGCCTCTGGATGAGCGACGAGCACCTGCCGGGCTTCCGTGCCGATTGTCTCGGCTTCATGAACCGCC
TGCATACCCTGTCCAAGAAGCTGATGATCTGCTTTGCCCGCGGCCTCGGCTTCCCGGACGACTACTTCCTGCCCTTCCAC
GACGTCTCCCGGCCCAGCATCCAGTCCGTCCTCCGGTTGCTGCACTACTTCCCCATCGAGCCACCAGCACCCGACAGCGA
CAAGCCGCCGACCATCTACCATCGAGCCGGCGCCCACGCCGACTGGGGCTTCCTCACCCTCCTCTTCCAGCGTCCCGGCC
AGGGCGGCCTCGAGATCTGCCCCGGCCGTGAGGCCGTCACCGAGTTTGGCCTCGGCGACACCTGGACCCGTGTCGAGCCC
GACACGGCCGCCATCGTCTGCAACATCGGCGACCTCCTCATGAGCTGGTCCGACGACCGCTTCAAGTCCACCTTCCACCG
CGTCAAGGCCCCCTGCGAGCCCGGCGACTTTTACGGCGAGCGCTACAGCGTCGCCTTCTTCAACCAGCCCTGCGCCGATG
CCATCATCCAGGGCCCCGCCAAGAAGTACCCTGCCGTCACCGGCGCCCAGTTCACCAAGAACGCCATGGATCGCCACTTT
GCCGCTCTGCAGGCCAAGCGCAACGCCAAGGAGGCTACTACCTCCACCCTGTCTTCCGTGCCGGCTGCAGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62