GenePrediction:GLEAN_6733 Details

Name: GLEAN_6733
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:441067..440483 (- strand)
Length: 585
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:441067..441063 (- strand)
Length: 5
Type: CDS
Source: GLEAN
Position: GCSC_156:440990..440714 (- strand)
Length: 277
Type: CDS
Source: GLEAN
Position: GCSC_156:440659..440483 (- strand)
Length: 177
>GLEAN_6733 class=GenePrediction position=GCSC_156:441067..440483 (- strand)
ATGACGTTAGTTTCAGTGACTGAAAGTCCAAGCCTCAGATCTATGCGTTGCTAACATGAAGCGTTTGGTTGCAACAGAGC
TGTACAGCGATTTAACGCACTCACCAAAGCAGAAGGGCTTCTCAAGGAGTCTGAGCTTGCACAAATTTTCGACGAGCTCC
CTCCTGTTTCTCCAGAAGCTATGACAGGCAAGTGGAATGGAGGCAGCTTTGACAGTGGCCATCCTGTCCACAAGCTGCTT
CAAACTTTTAAATGGGCAGGGAAAGAATTCCGCTCCGTTGACGATATCGACCCGATTGTGATCTTCGACGAAAATGGGGA
GCGAAAGTGGCTATCCGAGTATGGACATGCAAGAGTGAGTTCATCGAAGCTTCATTCACTTAGAAAGCTCAACTGACCCA
CCCCACAGCTGCGTGAAGTTAAGTTTCGGGGAGTTGTATCTGCCGCCTTGGTATACGACAAAGTTGCCATTATCGACTCG
TTTCGTCGGGTTTCGGACAACGTGCTGATGGGAACTATGGACGCCAGGGACTGGCCGGATGCTGGCATCTACTACTTTTA
CATCACCAAGTTTGAAGAATTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62