GenePrediction:GLEAN_6734 Details

Name: GLEAN_6734
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:439887..438438 (- strand)
Length: 1450
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:439887..439614 (- strand)
Length: 274
Type: CDS
Source: GLEAN
Position: GCSC_156:439549..438718 (- strand)
Length: 832
Type: CDS
Source: GLEAN
Position: GCSC_156:438603..438438 (- strand)
Length: 166
>GLEAN_6734 class=GenePrediction position=GCSC_156:439887..438438 (- strand)
ATGGCAGCAGCTGTGATCGCATCTCAAGTCTCGCACGGCCCTCCTGGCCAGCCGGACATCAGCTACACGCCAGATCTAGA
AAAGTACACGAACCGGTCGAAGAGGCGGGCAGAAACCGAAAAGCTTGGCCATGAGCTTCCTGCAGGGTTCCCGAAGAAGC
TGAACTCAGACCTAGTTTGGGACCGCGACAGCCTCGCAGGGAACTACGACTGGAACTACGTACTGACTGCGGACGACATT
GCAGAGATCCGCAGTGCACTGCAGCACTTCAAATGTGAGCACAGCAAGCCTTGTACGAGAAATCTGGAAAGATTATTGAC
GCCATTATTCTTGTGTAGCTCTCGGCAAGCCCATAAGTTTCGTCAGCCAGGAATCGTTTCCTCTACCCAATCTACATGCG
ATGCTCCGTGATGTATCCAGAGAGCTACACCAGGGCCACGGCTTCAAGGTCGTGCGCGGTGTGCCGGTGACTGAGCACAC
TCTAGAGGACAACATCATCATCTACGCGGGCATCTCGTCTCACGTAGCGCCATTGCGAGGACGCCAGGACGTGCAGTACC
AGGGCAAGCCAGCAGACGTCGTGCTCGCACACATCAAAGATCTGACGGGCAAGGTGGATGCGGCCAGCATCGGTGCGCCT
GCATACACGACTGAGAAGCAGGTGTTTCATACCGACGCCGGCGACGTGATCGCCCTGTTTGCGCTGGCCGAATCGGCCCA
CGGCGGCGAGAGCTACCTGTCCAGCAGCTATTGCGTTTACAACGAGCTAGCTGAGCGACGGCCCGACCTCATACGCACTC
TCGCAGAGCCCTGGGCCTTTGACGAGTTTGGCAAGTCGGCACGCAAGTTTTCCCTGAGACCGTTGCTGCATCAGGTGCCG
ATATCGACTGCCCTGGACAGCAATGAGAACAATGTTTCGTCTCATGTAAACGAGAAGCCCCGCCTGGTCATACAGTATGC
GCGGCGCTCCTTCACCGGTTACTGGGGCTTGCCGCGGTCTTCGGATATTCCACCCATCACTGAGGCGCAGGCGGAGGCAC
TCGATGCTCTCCACTTTACGGCAGAGCGCAACGCGGTGGCCCTCAATTTCCACCAAGGAGACATCCAGTATGTTAATAAT
CTGAGCATATTCCATACCCGGGGCGCCTTTACGGACTCTCCCGAGAAGCAGTAGGTGTTTTTTTTTCTTTTTTTTTCTTT
TCTTCAGTTCCTCGTGGTCAACAACGTTCACATAGCTCGTTCTACCTTTTGAGTCTCCTTTTACTAACAGCTGCGTACCA
CCAGTCGCCACCTGGTCCGTCTTTGGCTTCGTGACCCAGAATACGCATGGCCAACACCGGAGGCACTGAAAGACCGCTGG
GACCACCTCTACACCGGTGTGACCCCGGAGAAGTCTGTGTTTCCGCTCGAGCCAACTGTGAGAAGTGCTAGCAAGGGCAG
GGCAACGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62