GenePrediction:GLEAN_6735 Details

Name: GLEAN_6735
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:436835..435783 (- strand)
Length: 1053
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:436835..436792 (- strand)
Length: 44
Type: CDS
Source: GLEAN
Position: GCSC_156:436742..436701 (- strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_156:436647..436581 (- strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_156:436524..436484 (- strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_156:436278..435783 (- strand)
Length: 496
>GLEAN_6735 class=GenePrediction position=GCSC_156:436835..435783 (- strand)
ATGGCCGAAGATATCACCATGATTCCGGAGAGCAGTATTGGTATGTATATCCTGGGTGCTATATCTTACATTGCCACCAC
TAACGGAGCATAGGGGTCCTAACGATGACCGCCAAAATACGTCGCTCGATATCGGGTAAGCGTTGTGAGCCAGAAATGTA
CGAGCTTTATATACTAATTCTAGAACAGACACCATGCGCTCACAATGCTTATGGATGACAAGCTCTATCTTGCGCCCCTG
CCAGAGCATATTGATGTAAGTTAAATCATCCACCAAAAAAGCACTGCAGCTGACACAGTGTTCTGTGATAGAAAGCAATC
GACATCGGTACAGGAACTGGCATTTGGGCTATGTATGTTACCACCTCTGCCAAACTTCATTGACTTTAATTCAGCGGCTA
ATGAAGACAGCGATTTTGCAGATATGCATCCAGAGGCGACGGTCATCGGCACCGATATATCGCCCATCCAGCCACATTGG
GTCCCGCCGAACGTTTTCTTGTACTTGCTCTCTTTTCCTTGGCCCTTTTCATGTGATCCAACTGAATGTCCTTGTAGCCA
AATCGACGACTTTTCGAAGCCATGGACATTCGATGAAAATTCCGTCGACTACGTTCACGTGCGGTGGTTGTCTGGTTGCG
TCCAGGACTGGACAAAGCTGTTCAAAGAGGCCTTTAGGGTGTTGAAGCCCGGTGGCTATATCGAGTCCTGTGACTTTGAC
AGCAATGTCAGCTCGGATGACGGCAGCGTGAATGAGAAGATGGCTCTATCACAATGGGGCCACATTTATACAGAGGGCAC
TAAGAAACTTGGATTTCCAATGTCCTTTCATCCTGTTGGGGAAGGCAGGCAGCATAATGGTCTTAGAGATGCTGGATTCG
TCGATATTACCGAGAAATCCTACAAGGTAAGCCGGCGGCCTTGTTACATAATCATCTTACTCCTGGCTAATGGCTTTAGC
TTCCACTTTCCGAATGGCCGAAAGACGAGCGGCTACATCAAGTTGGAGCATACACTCATGCCACCTTCGCCAACGATTTT
GAAGGCTTCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62