GenePrediction:GLEAN_6736 Details

Name: GLEAN_6736
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:424060..421856 (- strand)
Length: 2205
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:424060..423890 (- strand)
Length: 171
Type: CDS
Source: GLEAN
Position: GCSC_156:423830..423753 (- strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_156:423670..423591 (- strand)
Length: 80
Type: CDS
Source: GLEAN
Position: GCSC_156:423220..423061 (- strand)
Length: 160
Type: CDS
Source: GLEAN
Position: GCSC_156:422886..422835 (- strand)
Length: 52
Type: CDS
Source: GLEAN
Position: GCSC_156:422728..422587 (- strand)
Length: 142
Type: CDS
Source: GLEAN
Position: GCSC_156:422519..422396 (- strand)
Length: 124
Type: CDS
Source: GLEAN
Position: GCSC_156:422343..422252 (- strand)
Length: 92
Type: CDS
Source: GLEAN
Position: GCSC_156:422180..421856 (- strand)
Length: 325
>GLEAN_6736 class=GenePrediction position=GCSC_156:424060..421856 (- strand)
ATGGCCAGCCTAGTCAAAGAGACTGCCGTGACAGGCATCAATGCCACGGCCAGTGACGAAAAGGTCGACGTGACTCGGGC
CCATGAGACGGGTTCAGAGAAAGGTCGAACGGGGCCGGCAGATCGGCGCGGTGCGACAGGTGAGATCAGCGCAAAGGAAG
AGCGTGCATTTGTGAGTACAGCGAGAGCCGACAAATCGGGTCCACGGAACTGACAGCAGTAACGTCGCAGGTGTGGCGGC
TCGACCTGGGACTTCTGGTGGTAGGCTTTTTGGGCTACACATTCAAGTATCTTGACCAGACAAACATTGTAAGTGGGCGA
GGGTTTCTTTGGTGCCTAGTTATCAATCTTCTGTCCTATCCAAGGTCTTTTTGGCTTACAACCATTGCAGAGCAACGCAT
ATGTTTCTGGCATGAAAGAGGAACTGCATCTGGAAGGAGACGAGCTTAACTACTTTACGACCTACTTCAAGTGAGTTGTC
TTGTCTAGACTTACGAGCTTTCTGTGGTTGCTGACAGACTCCTAGCATTGGATACATTGTCATGCTCTATCCATCGTGCA
TCATCGTCTCCCATTTCGGTCCCCACCGTTGGCTGCCGGCATGTGAGGTGATGTGGGGTATTCTGACCTGTTGCCTGTCA
CTATCCAAGTCGGCCAAGACAGTAAGACTCAGCCCAGCGAGCGTGAGGAGAAGAGAGCATTGACTGTCTGCAGGTGTATG
GCCTCCGTTTCCTCATCGGCCTTTTTGAGGGAAGTGCCTGGCCTGGCTACATCACCATCATCAAGTACGCTGGCTAGCTA
ATGATCTACAAAATGGAATGAGCTGACACGATTTCCGTAGCCAATGGTACCTTCCGGACGAGATTGCATTGCGCATGAGC
ATCTACAACGTCGCCCAGCCAACTGGAGCGATGCTCTCTGGGGCTATGCAAGGCTCATTGGCGACAAACCTCGATGGCAT
CCTGGGTCGGTCAGGCTGGCGATGGGCATTTATTATCAATGTATGTTTGGTTGCCCGGAGGAGATTTCCCACGAACAAAG
AATATATGCTGATCTCCACTTTGTTCGTAGGGTGTTTGCACCATTTTCGTGGCCCTGTTGGCGTTTGCTGTTCTTCCTGG
ATATGTACGCTTGGTTTAGACAGTACATACAGACGCCAGACTAATGAACTGCAGCCCGAACGTCAGAATCCCCTATCTAA
ATACTACATGAAGCCTCGCCACATAGGTATGTCTTGCTCTGCTCTTTCAACCTTTGCAAATAGTAATATTTGAAGAAATT
GCGCTTGCACGGGCACGTCGTGTCGGTCGCAGAGCGCAAAAGGGCATTACAGTCAAGAGCTTTTTGCGCTGCTTTTCTTT
CTGGCAACTGTGGCTGGTTGCTATCGCCTGGCCGATTGGTGGCAACACGACACCATCTGGATACTTCAACCTGTGGCTGA
AATCACTGAAGAACCCAGACGGGACGAAGAAATAGTGAGTTCCATAGCTGTCAACTCGACTTATGTGGCCGGTCTCCCGC
TTCCTTTCACTGACAATGCAGTTCTGTCGGCATGCTGAACTATCTACCTATCATTGGGCAGGCAGTGCAGTTTGTGGCCG
AGATTTTGTTCAATGGCTTCAGCGACCTTCTGGGCGCACGACTGCCGTTTCTGCTCCTACATTCAGTGTGTAGCACCTGT
TCCATTTCGTGGATTAACCTCTAACTGGAAGATTTAGGCAATCAGCATCACGTCACTCATAATCCTGATTATCCGGCCAA
GCAACCATCACTCTTACATGGCCGGCTGGTATCTCAACTACGTAGGAGGGTGAGTTCGATCTTCAATAGTCCCGTGCAGG
GCCATCCTTGAGAACGTCGGCTGATAAACCTCTCCCCAAGTGTCTCCACTATGCTCCTCTGCTCCTGGGCAGCCACGCAT
CTACAGAGCGAGCCGGAAGTACGCACGGTACTCTTTGCAAGTGGCACGATTCTGGCATACCTGCTCAGCGCCTTTGTGCC
GCTGGCCGCATACCCAGCAAAACAAGCGCCCAATTGGCACATTGGAGCCAAGCTGTATTTAGGCTTTGCGGTGGCGTCTA
CGATCCTCTTTATCGTTATACACTTTGCCTTTCGATACGAAAAGACGCGGCAGGCGTCAATAGTGCCAGCTACGGACGGT
ACTGGGCTACATCACGAAGGGCTAGGGCTAGAACCGAAAGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62