GenePrediction:GLEAN_6737 Details

Name: GLEAN_6737
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:416331..415591 (- strand)
Length: 741
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:416331..415849 (- strand)
Length: 483
Type: CDS
Source: GLEAN
Position: GCSC_156:415794..415591 (- strand)
Length: 204
>GLEAN_6737 class=GenePrediction position=GCSC_156:416331..415591 (- strand)
ATGCCATACTATCATGAGGCTTTCAATAACTCTTCGGCTCGATACGATAAAACCTTGGGACGCTATGTACCTGCTTCGAT
AGCTATGGTCAAGCAAACCGTACAATGCCGCTCTGAGGCCGACGAGCGAGTTGATCAGTTTCAATTGGCCAGGCCACTTT
TAGGCAGTTCAGTGCTGATGCGGTTCTGGAACAATATTTTCACTGACTCGCTGCACAAGTTCAATTCCCAGTACTCGGAG
CCCAGAGGTCGGGCAGACTCGGATTACGCTATTAGGAACGCAGACGACTGGGAGGGCGTTTATTCAAAGCTACAACTGGC
ACGTGAGAAATACGATTCGAAAGCAAAAGGCTGCAGAGGTAGCTTCAAGAGGTTTACTCGCAAGGTAGCCGATCAGGCGG
GTTCGGCTGCTCGACTAGCCAAATTCATTCCTGAAGGCACCTGTACAACACCTGTGAAAGCTGCGGTGGAGGTCCTGCTA
GATGTACGTCCACATTTCATTAAACCAATTCATGTACTGACAAAAACAAAACTTAAGGCGGTCAAAGTGGCGTCTGAGGT
GCGGAAGGAGGTCAATAGCTTTGATGGCGAAAAGTTGGATCAATTGTTTGCCGACATCGAGGTCTTTCTCGGCACGTATC
CCAAAGATGAAAATATCAAAAAGGCATCGGTGGACCTCGTGGTGGCTATCCTAAAGGCGGTAGAGGACGCTATCGGCTTC
TTTACCAAGCATTCGGGTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62