GenePrediction:GLEAN_6739 Details

Name: GLEAN_6739
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:406552..403368 (- strand)
Length: 3185
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:406552..406000 (- strand)
Length: 553
Type: CDS
Source: GLEAN
Position: GCSC_156:405943..404499 (- strand)
Length: 1445
Type: CDS
Source: GLEAN
Position: GCSC_156:403985..403368 (- strand)
Length: 618
>GLEAN_6739 class=GenePrediction position=GCSC_156:406552..403368 (- strand)
ATGTCTGGACTCGCACTTGGGACAAAAGGCGTGGACCTGGTCTCACAGGGAACTGGCTACGGCCTGCTCATCGGCCTCGG
CGTCGTGTTCTGTGGCGTCATTCTGGTGGCCGTCAAGATCCAGAGGGTGTATCTGTCCGAGGACAATGCGACGTCAGAAA
TGTTCATGGTGGCCAACCGGTCGGTGGGCACGGGGCTGACAGCGTCGGCCGTATTCTCGTCGTGGATGTGGATCAACGAG
ACGGTGTTCGCGTCGGCCATGTGCTTCCGCTACGGCTTGGCAGTGCCGTTGTGGTGGGCCACCGGGCTCTGCTTCCAGAT
CGCGCTGATGGCAGCGCTGGGCGTGTTGGCCAAGATCCGCGTGCCGTATGCGCACACGTCGCTGGAAATCATCCGCATGC
GGTACGGCAAGATCGGTCATGTCGTGTTCATCGTGCTCAACATAACCAACAACGTGTTTGGCTGTGCGTCCATGATCCTG
ACGGGATCGCAAATCATCCACGGCATCTCAGGCATGCACTTCGTGGCGGCCACGATTCTAATTCCGCTGGGAGGTAAGGA
TGTCTCGTGTTGCTCTTGCTTGAACTTTGCGTCTAGCTAACCCTACCAGTGGTCCTCTACACCGCCGTCGGTGGCCTCAA
GGCAACCTTCCTGACAGATTATTTGCACACAACCATCGCACTCATCCTCATCATCTACTTCACGCTCAGCGTGCTGACGC
ACCAGGCCGTCGGTGGGTTGGGTGGCCTTTACGACATTGTCACGGAGACGGCGTCCAAGAACTACATCAAGGGCAACTTT
GAGGGCTCGCTGCTGACGATGAAGTCCAAGAACGCCATAATCTGGGGCCTCATCCTCAAGTTTGGCAACCTGGCCCTGGT
GGTGATGGACACGGCCTTCTGGCAGAAGTCGTTTGCCACCGAGGTCGGCGCAACGGTGCCGGGCTACGACCTGGCGGCCC
TGGCCATCTTCGGCATCCCCTGGGGCCTTGGCACGGTGATCGGTCTGACGGCACGGGCGATCCAGTACTCGCCCATCTTC
CCGACGTACCCAAACCCAATGTCACTGGCCGAGGTCAGCGCGGGGTTTGTGATGCCGTACACGATCAAGGCGCTCATCGG
GACGCACGGCATCGTGGCCTTTTTTGTGCTGCTGTTTATGGCCCTGACGAGCACGGTATCTTCGTCTATGATTGCCGTCA
GCAGCATCCTCTCGTTTGACGTGTACAAGACGTACACCAATCCGCGGGCGACGGACAAGACGCTCGTGCATGTCAGCCAC
TACGCAGTGATATTCCATGCGGTGTTCATCACGGGCATCTCGCTCGCGCTCAACTACGGCGGCGCTGACATGACGTGGAT
CGGCTACTTCCGGCCAATTCTGTCGTGTCCGGGCATCATCCCGCTGGCTCTGACGCTGATCTGGGACCGGCAGACGAAGC
TTGCGGCTGTGCTGTCGCCCGTTCTCGGCTTCTTCACCGGCCTGGCCATCTGGCTGTTGACGGCGTACCGGCTGCACGGG
ACCATTAACCTGATCACGACCGAGGCCGGCCTGCCGGCACTGTACGGCGCCTGCGGCTCGTTCTTCTCGCCGGCCATCTA
CTCGGTCGTGCTCTCGCTGTACAAGCCGAGCCGATTTGACTGGCGCGAGTTTTTGCGGATCGAACTGGCGGACGAGGCCC
AGATACACGCAGACGACACCACGGGATCGGACAAGACGGCGTCCTCAGGCGACGAGGCAGGCAACGAGAAGCAGGCCGTG
GCCAGGCAGTCACCAGTGGGCGCGGCCGAGCTGTCGCTGGACGACGTACGCCACCCGTTCGACGAGGCCACGATCAAGGA
GCTGTACCGGTGGTACAAGATCGCGTGGGTCTTCTGGGTGGTGATTGTGCTGGTGACGTTTGTGGCGTGGCCGATGCCGC
TGTACCGCAACTACATCTTCACTAAGCCGTTCTTCTTGGGCTGGGTAACGGTGGCGATCATCTGGCAGTTCTTTGCCTTT
TTCGCCGTGGCCGTCTACCCGGTCTACGATGGACGAGGCGATATCATCACGGGGGTCCGTGGGGTCTACCGGACTGTCCG
ACAGCTCCTGAAGAGAGAGAAAAGATAAGATAGACACAGCCCAGAGATATGTAGAGATAGAAACACGAACAGACGCGCGT
CCTTTCAACATTGCACGGAAAATGCAGTGCCTTGCTGGCCTTCTTAGCAGCTCGCCCAACAGCGGCCGTGGATGGCTGGC
CATGTGTCGAGCCACGCGTCGACTAGGTGGCTTGCATAAATTCGGTGTTTATTGAGCGGACTTGCAGGTGGGGGAAGAGG
GGTTAGTATTGTGTACTGTCGATCCCTGTAGGCTTCCAATTGAGCTCAGCTCGCCCATGGCAGCCTTCGGTTCCACACAG
CCGTTCTGCCGCATTCTGTCTGAGTCAGCTCTCATTGTTCTTTATCGGAGCATTCTCCAATCCCTTTCATCTGGCATTAC
CATTTTTTAGTCTTATTTTTATTGTTTCTTCCAACGGCAGGCGACCCAATGTCTCCACCCGACCTCACAGCCTATTCGGT
CGATCAGTCTCTGGCCGATTGGGACATCACGCCGGCCGAGTGGATGCGGCGGAACAGCCACGACGACTGGAACGGCCTGG
CAGTGTCGGTGGTGGTGTTTGATGGCGGCAGCAGCGATGGCCCCCGTCGAGTGTTGCTAGTCCAGCGCGCTGCCCACGAT
TCGATGCCGAACCGATGGGAGGTTCCGGGCGGTGGTGCCAGCGAGCCACACGAGAGCCTACTGCTGGCGGCCGCCCGCGA
GCTTTGGGAGGAGGCCGGCCTGGTGGCCACACGGTTTAAGGCCCTGGTGCCGCTGCGTGCTGTCGAAGGCGTCGAGGGCG
TCGACGAGGTGGCTGCCCTCGTCGCTGCGGCCGACCATCCAGGCCACGTCTTTCACAACCGCACCGGCACCCGGCTCTTT
GGCCGGTTCGCCTTCCGGGCAGATGTGCAGCAGACGACAGCAGTCGTGCTTGATCCCAATGAACACCAGGACTACGTCTG
GGCGACCGAAGAGGAAGTCCGGCTACAGCGACAGATCGGGCAAGACAGCAACGACAGCAGGCCACTACCTCTCACCCATC
CAGCCACACAGGCATTCATCCTTGAGGCTTTCAGACAGGCGGCAGAAGCAGAAGTAGACAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62