GenePrediction:GLEAN_673 Details

Name: GLEAN_673
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1364879..1366716 (+ strand)
Length: 1838
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1364879..1365553 (+ strand)
Length: 675
Type: CDS
Source: GLEAN
Position: GCSC_97:1365670..1366716 (+ strand)
Length: 1047
>GLEAN_673 class=GenePrediction position=GCSC_97:1364879..1366716 (+ strand)
ATGACCACCCATAGCAGCTACAAGGTGGTTGAGCAGCCGATGGGCACGGCGCGGCCGATCCGCATCATCACGATCGGAGC
CGGAGCCAGCGGGCTCAACGTGGCGCGCAACGTCAAGGAGCACATGCAGAACGTGGAGCTGCAGATATACGAGAAGGACG
GAGCTGTCGGGGGGACCTGGCTGGAGAACAGCTACCCGGGCTGTGCCTGCGACATTCCGAGCCACAACTACCAGTACTCG
TGGGAGCCAAATCCGACTTGGACGGACTACTACGCATCGCAGCCCGAGATCCTGGCCTACTTTACGCGGGCAGCCGAGAA
ACACGGGTTGCTGCCGTACGTGAGATTCGGTCAGCGCGTCACTGAGGCCGTCTGGCACGAGGACGAGGGCCTGTGGCGCT
TCCAGATCGAGGATGTGGCCACAGGGACGCAACATGCCGACTATGGACACTTCTTCATCAACGCCAGCGGTTACCTCAAC
AACTGGAAGTGGCCGGCTATTGACGGGCTGCACTCGTTTGGTGGCACGCTGCTGCACAGCGCTGCCTGGGACGACCAGAT
CGACCTCCACGACAAGACCGTGGCCGTGATCGGCTACGGGTCCAGCGGCATTCAGGTCGTCACGGCGCTGCAGCCGGTGG
TCAAGCATCTGACAACGTTTATCCGGGGGCCAACGGTGAGTGTGTATTGTGTTGCTGATGCTGGCGACGATGCTATGATG
CTTTTATGAGATGGCATGTGGATATGTGGATATGCTGTTCGCTCATCTTCGAAGCCTGCTAACTTCCCCAGTGGATCACT
GCTGGTTTTGGCAGCAAGTATGCTGCTCCCGGCGGCCTGAACTTTGCCTTTTCCGACGAGCAGAAGCAGCACTTTGCGTC
CGATCCGGCTGCCTACTTGGCCTACCGCAAAGGCGTCGAGCACGAGCTGTCGAGCCGGTTCCGTATGCTGCATGCAGACA
CGCCCGAGCAGGCGGCTGCAGTGGCCTTTTCGCGTGCCGACATGCGGCGGCGGCTGGGCGTCAGCGACGAGACATCCGCA
GCAGCTACAGCGGTGAACCCGCGCAACAAGGCGCTGGCCGACTTTCTGATCCCAGACTTCCCCGTTGGCTGTCGCCGTCC
TTCGCCCGGCAACGGCTACCTCGAGGCACTCTCGGCTGACAACGTGCGCGTCATCACGGGCACGGAGATTGTCCGTGTCG
AGCCTGACGGCCTCGTCATGGCTGGCTCTGGTGAAAAGGTTGCGGTCGATGTCATCGTCTGTGCCACCGGCTTCGACCTC
TCCTTCCGACCGCGCTTCCCCATTGTCGGCCGTGGTGGCGTCGACCTGAGCGACGCCTGGGCTGAACGCCCGACTGCCTA
TCTCTCCATGACGCCTGCCGACATGCCCAACTACTTTATGTTCCTCGGCCCCAACGCGCCCGTTGGCCACGGCTCCGCCA
TCCCCATCATCGAGCACCTCACAAAGTATATGCTCCGGATGGTCCACAAGGCCCAGACCGAGGGCTATCGAGCCTTTTGT
CCACGACCGGCCGCTATCGACGAGTTCGTCCAACACGCCGATGCTTTTCTTCCACGCACTGCCTGGGCCGGAAAATGTCG
CAGCTGGTTCAAGAACGGTCGCGAGTCCGGCCCCGTTACCGGCCTCCACCCTGGCAGCCGTCTGCACTGGTTTCACCTGC
TTCGTGAGCCCCGCTACGAGGACTGGGACTGGACCTCCTGCAGCCCTAACCGCTGGGCCTATCTCGGCAACGGCTTCTCC
GTCATGGAGGCCGAGGACCGCGATCTCACCTGGTACTTTGACGCGCCCGAGAAGGAGTACGAGGCCTTTGTGTATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62