GenePrediction:GLEAN_6740 Details

Name: GLEAN_6740
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:396928..394605 (- strand)
Length: 2324
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:396928..396564 (- strand)
Length: 365
Type: CDS
Source: GLEAN
Position: GCSC_156:396486..394605 (- strand)
Length: 1882
>GLEAN_6740 class=GenePrediction position=GCSC_156:396928..394605 (- strand)
ATGAGCCTCGACGTGCCTGGAAGTCCCCTGGGAGCTATCCCAGGTCTTCCCGAGAAGTCGGCTCCGCAGTATGAAGAAGA
TTCAGAATTCGAGTATACCATTGATGACAGCGTCTTCGACAATGAAGCTATCAACCTTGGACTGTTCTCCCCACCCATTT
CCCATGTCCCCAAGTTAAGGGTGCCGAATAAGTTATTTCGTGGCCCGCAAGATGGGCCAGACAGTGACTCCGATTCGGGG
GACTCCAGCTCGGATTCGAACTTGGTCGAAGGAACTTCTCCCAAAGAGTACAAACGACTTGAAACGGGTAGCTACGAGCA
AACATCTGCCCTACTCAATCTGACCTACAGCAGAGTAGAGAAACTGTGAGTCAGCCAAGTGTCTCATCGCTGAAGCAGCA
CCACATGCAGTGCTAAAGTTCAACTCTTTTCCCCTGTCACAGCTACGAGGCATACTTCCACGCAAACCAGACCCAGCCAC
TGTTCCCGTATCGTCGCACAATAGTGGAGCAGAAAAAGATCTATCAGTGGACATCTTCTCCCGACCAGGATCCTAATGAG
AAGTACCCGCCCCATCTACAAACCATCCCGAAACCTGATCAAGAAAGCCTGTGGGCCATTTTCAATATCTTTGGCCTTGC
TCAGACTGGGATTATGCTTAAATGTGTAATTCCTGACCAGATTGTGAAATTCGCGGGTGCTTTGAAGGATATCAGCGAAG
TTCCCAAGACCATCGCCGGATACGAAGACTTCAACAAGACGCACATCAAGGGGGGAAACAATGTCGTGGAGAAGGGCAAA
AATCTCGGCCAGTTGGAGGATTGGTTTACGGACCGCCGCTTTGCGGAGCAGTCTTTCACCGGTGCCAACCCGACGACAAT
TGAGGCGATCGGAGAGCACGACGATGCCAAGGAAGCTCTCTTGAAAGAGTTCATCGCATCCGCCGAAAAAAATGGCTACG
ACAAATGGGCTGCAATGCTGAAGACCATCCCGCATGACTCGCTGTTCGTGCAGGACTGCCGCTACTTCCGCGAAGCCATC
GGACTGCAGCCCGAAGAAGATATTTTCTACGAGGAAGTGAGGACGAACCCAAAGCAGGAGAGTGACCCGAACTGGGCGTG
TGCTTCTGTCACGCTCTTCCAGCTGCACGACAACGGTCGGCTGCACCCGATTGCCATTGTGTGCGACTACAAGAAGAACA
TGGCCACGTCTGTGACCATCTTCAACAGTGCGATGACGCCGGCCGACCCAGAATCAAAGGACGCGGAAGAGAAGAGCAAG
GACCTCTTGCGCCAGAAGAACGACTGGCCCTGGCGGTACGCCAAGACGTGCGCACAGGCGGCAGACTGGATTCGCCACGA
GGTCGGCGTGCATCTGACACGCGCTCACATGATCGAAGAGAGCCTGATCGTGGCCACAAGCCGCTGCATCCCGACGGATC
ACCCCGTTCACCAGCTGCTCAAGCCGCATTGGGTCCGGACACTGTCGCTCAATGCCGCAGCCCGGTCGATGCTTGTCCCG
CAAGTGGTTCTCAACCTTGTCGGCATCAGCCTAGACGGCCTCTACAACTACATCAATTACGAGTACAGCAACTTCGACTA
CGAACAAAACTATGTGCCGAACGATCTCAAACGGCGCGGCTTTCCCACCGATACGAAAGAGCTCAACAGCAACCCGAAGT
ACAAGAACTATGCTTACGGCAAAAACATTCTGTTGATGTGGAACGTGCTCCGTACCTATGTCCACGACACGCTCGCGCTT
ACATACAAGTCCGACGCCCACGTGAAGAGCGACAACTATCTCTCGGACTGGGGAAACGATATCCGCACCAACGGCAAGCT
CAAGGGTTTTCCCGAAATCGATACGCTCGACAGACTCACCGACGCCGTCACGATGGCCATCCACATCGCTGCGCCTTTCC
ACACCGCCGTCAACTACCTCCAGAACTACTACCAATCGTTTGTCATTACAAAGCCGTCCTCACTATGTGCAGCACCGCCC
AAGACACTCGCCGAGTTGAAGGAGTACACGGAACAGACTTTGACAGCCGCGCTGCCCATCGGACGTATCCGTCAGTGGCT
CCTTTCTGTGCAGCTACCATGGCTTCTTAGCTTCAAGGTCGAAGACCTGCACAGCCTGATGAAGTTCTCCTCGTCGCATG
TGGCCATGAGCAGAGGTGAAAGAAAGAAGATTAATATAAAGTTGCACCAACAGCTTTTGGAGTTGGACACGGTTTTCAAA
AAGAACAGTGACGAAATGGATGAGGGCCACATCGAGTATACCGTAATGAATCCGAAAAACATGGCGGTTTCTATACTTAT
CTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62