GenePrediction:GLEAN_6741 Details

Name: GLEAN_6741
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:391467..390413 (- strand)
Length: 1055
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:391467..391281 (- strand)
Length: 187
Type: CDS
Source: GLEAN
Position: GCSC_156:391191..390413 (- strand)
Length: 779
>GLEAN_6741 class=GenePrediction position=GCSC_156:391467..390413 (- strand)
ATGCCCTTGAACGTCCTCATTGTCGGCTGCGGCGCCGTTGGCACCATGTGCGCCTTCGCGCTGCACCAGTCCGGCGAGGC
CACGGTGACGGCCTTATTACGCTCCAACTACGACGAGGTGCGCGAGAGCGGCCTGCACATCCGTAGTGTTGACCACGGCG
AGGTTGACAGCTGGCGGCCACATCACAGTGAGTTGTGGTCCTGACTGTTGGACATGTCCCTTTCAAGCTTGTCATCTCTG
TCACCTCACCTTCTCTCTCCCACCTGACACTCACAGTCGTCAAGTCCATTGCTGAGGCCAAGGCACACGGCCCTTTTGAC
TACGTCCTCGTCGCGCTCAAGAACCTGCCGGACGTCTACAGCATCGCGGACATGATCGCGCCCGTGGTGACGGCTTCGCG
CACAGCCGTCGTGCTGGTGCAGAACGGCATCGGCATCGAGGCGCCGGTGGCGGCTGCTTTCCCGGACAGCACGCTGCTGT
CGGCCGTGTCGCTGATCGGGGCCGAGCTGGACGGCCGCGAGGTGCTGCACAACGACTCGGACGAGCTGATCGTGGGTGTC
TGGGGCGACGCTGCGCAAAAGGCGGCCGGGGCAGCTTCTTGCAAGGCCTTTGCGGCGGCCTACTCGCGCGGGGCGGCGCG
CTGCGACGTCGTCGACGACATGCAGTGGTACCGCTGGCGCAAGCTCGTGTGGAACGCCTCCTTCAACACCGTCTGCGCCC
TGCTCGACCTCGACTCGGGCACGGTGCAGGACGCGGCCGGCAGCCTCGATTCGCTGATACGGCCGGCCATGCGCGAGGTC
GTCGCCGTGGCGGCGGCCGCTGGCTTCACGCTGCCCGATGACGTCATTGAGGCCGCGATCGCGTCCATGCCCAAGGCCGT
GCGCTGTCGCCCCAGCATGCAGGTCGATGCCGTCCGTGGCCGGCCAATGGAGGTCGAGGCTATCCTCGGAAACGCCGTCG
ACGCCGCCCGCGACCTCGCCGTGCCCGTGCCCGTGCTGCAGACACTCTGCAGCCTGCTGCGGGCGAAACAGTGGGCCATC
CTTAACAAGGCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62