GenePrediction:GLEAN_6743 Details

Name: GLEAN_6743
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:284345..282473 (- strand)
Length: 1873
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:284345..284265 (- strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_156:284152..283887 (- strand)
Length: 266
Type: CDS
Source: GLEAN
Position: GCSC_156:283814..282473 (- strand)
Length: 1342
>GLEAN_6743 class=GenePrediction position=GCSC_156:284345..282473 (- strand)
ATGGGCTGGATACACACTGTCAACCAGAGGGTTGCCGCGAGCCCGGTAGGCAGGTGGTTTCGGCTGCAAGGTTGCGGACA
CGTATGTAATCACCCGATCGAGCAATGCCGTTGTTTCAGCCTCCAAAGTCGAAGGGATTTGTAGGCATGCATCTCTGGGA
AAAGGGTAACAACTAACGCGAGTATATCTATAGCCAAAGGAGCGTAAAAACTCGTTCTTCTTTACCGAAATCCGCTCTGG
GTTGGCTGCCTTCTTTGCCATGGCCTACGTCATCTCTGTCAATGCCTCTGTAGTGTCAGACTCCGGAGGCACATGCGTCT
GCAATGACCCGGTTGACATCAGTTGCTCCACGGATGTTGATTACGCTCTCTGCGTCAACGAGATCAAGAGAGACCTCGTG
ACGTCCACTGCTGCCATCTCGGCCCTCACGTCCTTTTGTATGGGCCTCTTTGCCAATCTGTGAGATAATCCCGGTCCTGA
CGGTGTGATATCCGGTCTTCCTGCTGACAAACGGAACTTCATCCGGGCCAGTCCAGTATCGTTGGCGCCGGGCATGGGCC
TCAATGCCTATTTTGCCTATACCGTTGTGGGATATCACGGCACCGGCAATGTCCCCTACGAGGTCGCCCTTACGGCCATC
TTCGTGGAGGGATGGATCTTCTTTGCACTTGCTCTCTTTGGGATGCGCCAATGGCTGGCACGTGCCATTCCTGCATCCCT
GAAGCTGGCCACCAGCGCTGGTATCGGCCTCTTCTTGACCCTGATCGGCCTGACCTACAGCGAAGGTATCGGCCTGATGG
TGGGAGCTACTGATACGCCGGTAGCACTCGCCGGATGTCGCGAGGAGCTACTTAACGAGTCAGGCCAGTGCCCAAGCTCT
GCCAAGATGCGCAATCCGGCGATGTGGGTCGGCATCTTCTGCGGTGGCATCCTGACGGTCATTCTGATGATGTATCGCGT
CAAGGGCGCCATCATCGCCGGAATCGCCCTTGTCAGCATCATCTCATGGCCACGGACATCGGCGATCACGTACTTTCCAT
ATACGCCAGAAGGTGACGACTTGTTCAGCTTCTTCCGCCAGGTCGTCAGCTTTCATAAGATCGGCCAGATACTCAACGTC
CAGAGGTGGGACATCTCCGAGTACGGTAGCCAGTTCGGGCTCGCCCTCATTACGTTTCTCTACGTCGACATCCTCGACTG
CACGGGTACGCTGTATTCCATGGCCCGGTTTGCCGACATGATCGACCCCGTCACGCAGGACTTCGAAGGCTCCTCTTTCG
CGTACATGGTTGATGCCATTGGAATTTCCATCGGTTCGATCATGGGCAACTCCCCCGTGACTGCTTTCGTCGAGTCCGGA
GCTGGTATCTCTGAAGGTGGAAAGACGGGGCTCACAGCTATGACTACAGGCATCTGCTTCTTCATCTCCATCTTCTTCGC
GCCCATATTTGCCTCGATTCCTCCCTGGGCCACTGGGTGCGTTCTTATTTTGGTTGGATCTATGATGATGAAAGCTGTTA
CGGAAATCAACTGGCGGTACATGGGCGATGCTATCCCCGCCTTCTTGTGTATCGTCCTGATGCCATTTACGTACTCGATC
GCAAACGGTTTGATCGGTGGTGTCTGCACCTATATTCTGATCAATACCCTGGTATGGATTATCGAGAGGGTATCGGGTGG
CCGGATCGTGCCTCAGGACAAAGATAGCAAGGATCCATGGACGTATCGAATTCCAGGAGGATTCTTTCCTCCCTGGCTTG
TGCGCCTGTCAAAGGGCAACAAGAACTTCTGGCGAGAGGAGCCAACCACAATTACAGAGATGGTGGTTGAGGAGAACCCG
TCAAAGGTGACGAGCGCGAGCGAAAAGGTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62