GenePrediction:GLEAN_6744 Details

Name: GLEAN_6744
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:272895..272503 (- strand)
Length: 393
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:272895..272702 (- strand)
Length: 194
Type: CDS
Source: GLEAN
Position: GCSC_156:272641..272503 (- strand)
Length: 139
>GLEAN_6744 class=GenePrediction position=GCSC_156:272895..272503 (- strand)
ATGTTTGTGGAGGGTGTGGACGTGCTGGTGATTGTGGTGGCGATGGACGAGCTACACGTGCGAGAGATGGAAAGACGACG
GGCGAAAGATGAGGCGGCCGGAACGGCCGATGCCAAGACGAGGGTGACCGAGCCGAGCCCTGAAATTTCTCAGATTACGT
CCATTGCGAACGGCATGGAGGTGGTCCTGCAGCGGTGGCGAGAGGAGGACGAGTGAAGAGAGGCGAACCGGTGTGTTTCT
GATGGTCCTGGCAGCCGTGAGCAGGCCGTGCTGAAGGAGAACGGGTTCATCGGTGAGATGCGCATGCGCATCATGGCGCT
GCACACATACGTGGACCAGCACAGGTTATCTCGGCTGACGCTGCCGGCCGGACGTGGTTCGCAGCACGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62