GenePrediction:GLEAN_6745 Details

Name: GLEAN_6745
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:268212..266848 (- strand)
Length: 1365
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:268212..267756 (- strand)
Length: 457
Type: CDS
Source: GLEAN
Position: GCSC_156:267686..266848 (- strand)
Length: 839
>GLEAN_6745 class=GenePrediction position=GCSC_156:268212..266848 (- strand)
ATGTCCTCTAAACTTCACGTCGCCATTGTTGGTGGCGGGATCACCGGTGTCATGCTCGCCATCGGGCTGCACGCGCGCAA
CGTCTCCTGCACCATCTATGAGCGTGCCTCTGGCTTCTCTGAGACGGGTGCCGGCATTGGCATCAGCCCCACCGCCGAGG
CAGCAATGCAACTCATCGATCCAGCAGTACACGCCGCCTTTCAGGCCGCCGTCACGCCCAACGGCGAGGACTACTTCCAG
TGGATCGATGGCCACACCACCGACAGCGTCATCTACCGTCTACCCCTCGGCAAAGATGGTTTCCAGGGTGGCCGCCGCTC
CCAGCTGCTGCACTGCTGGGCAGCACTCATTCCACCAGATCTTGTCCAGTTCCGCAAGGAGCTCGTCGGCCTCAACGACA
GCGGCACGACGGTTACGCTGCAATTTGGCGATGGCACGACCGCCACAGCAGACGCAGGTTCGTTCTCCTGATTGCCTGGA
TTTTCTTCCCACTGTTATCCTATCTCACACCTCCTTTCGTCTCCAGTTATTGGCTGTGATGGCGTCTGGTCACGCACGCG
ATCCCTCGTCTTTGGGGACGCCTACCGCGCCACGTACTCCCACCAGTACTGCTTTCGTGCTGTTGTCCCCATGGCCGACG
CCCGTGTCGCTCTGGGCAACCAGCGCTCGTCCACACGGTTCATGTTCAAGGGGGCTATGCTCAACATCCTCGTGGTCGTG
TCGGATCCCAACCCATGGCCAGAGACAAGCAGTGAAGTAGATGGCGGCATCGTCAAGGAGGCTTCGCCTGCTTCCTCTGC
CACTTCTCGTGGTAATCGAGAGGATGCAGAACGGGCCTTTTCCTCGTGGCAGAAATGTTCTCGCGCTGTCGTCAGCCTCC
TGCCGTCTAAACCCGATCGTTGGGCCATCTTTGACCTGATGGAGCACCCGCTGCCCACTTACGCCCGCGGACGTATCGCT
GTCGCCGGGGACGCCGCCCATGCTGCAGGACCACATCTCGGAGCCGGTGCTGGCTTCGGCATCGAGGACGCTCTTGTGCT
GGCCGAGCTTCTGGCTGGTATTGCAAGGGATAATCATACAACAACGAACACGTCTGCTTTTCCCGCGCGGATCACCGCCG
CCCTCTCTGCCTACAGCGACATGCGCTATGACCGCACTCAATGGCTTGTCCGTCACACACGTGATGCCGTGGACCTATTT
CAGTGGAGGGATGAGTCTGCCGGCCAGGACACGGAACTGTTTCAGCGCGAGATAACCTGGCGTTTTCACCACATTTGGAA
CAACGATGCCTCCGCCATGGTGACCCAAGCACAGGACACATATGACGAAAGATTGAAGCAAAGTCTCCTTTCTAAATCAG
AGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62