GenePrediction:GLEAN_6747 Details

Name: GLEAN_6747
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:258681..257220 (- strand)
Length: 1462
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:258681..257990 (- strand)
Length: 692
Type: CDS
Source: GLEAN
Position: GCSC_156:257940..257220 (- strand)
Length: 721
>GLEAN_6747 class=GenePrediction position=GCSC_156:258681..257220 (- strand)
ATGGCCGTGGTTGTCTCTGCAAAAGTGCTAGAGAAGGCTTCAGAGCCTGCAGCAGTGCAATCGACCGAGCCATGCCTCCT
TTATCGGTCGCTGATCGAGCGGCCGAGCAACGTGGAGATGGCAACTGGCAGCTATCTCTATCTAGATGACGGGCGCAAGA
TCCTCGACGCCTGCGGCGGAGCAGCAGTGGCGGTCCTGGGACACGGAAACGCCGAAGTGATCGGAGCTGTGATGAAGCAG
ATGCAAAAGGTGTCGTATGTGCACACTCTATCGTACGGCACAGACTCGTCCGAGGAGCTGGCGCACGCGGTGCTGCACTT
TTCCGACGGCAGTTTCGACCATGGCCTTGTCAAGGCCTTTTTCGTCGGCAGCGGCAGCGAGGCCAACGATGCTGCGATGA
AGTGTGCGCGACAGTACTGGTACGAGAAGGGCGAGACGCAACGGCGGTTCTACGTGGCGCGCAAGCAGAGCTATCACGGG
AACACGATTGGGAGCATGTCGATCTCGGGCATGGCCGGCCGCAAGATGCCGTACAACGAGATTTTACCGACCAATGTGTC
GTTTGTCAGCGCAGCCGATGCCTTCCATGGCCGAAAGGCCGACGAGACAGAGGCAATGTTTGTCAGCAGGCTGGTGGCCG
AGTTAGAGGCCGAGTTTGTGAGGCTGGGGCCGGAGAATGTGATTTCGTTTATGTGAGTTTATTTCGACTCATCTTGTCAT
GCTACCCCTAACATGTCCCAGCGGCGAGACGGTCAGTGGCGCGGCACTCGGCACGCTTGCAGCTCCGACGGGTTACTGGC
GATCGGTGCGCAACCTCTGCGACAAGTACGGCATCCTGCTGCACATGGACGAGGTGATGTGCGGCACCGGGCGGACGGGC
TCGTACTTTGCCTTTGAGCAAGAGGGCATCCGGCCGGACATTGTGACGGTCGGCAAGGGTCTCGGCGGCGGCTATGTGCC
CATTGCCGGGATGCTCGTCGGCGATCGCGTCGTCGACGCCCTCCGACACGGTTCAGCCACCTTCAACCACGGTCAGACGT
ATCAGGCCCATCCGGTCTCGTGTGCCGCCGCTCTGGCAGTGCAGACGATCCTCCGGCGGGATGGCCTCGTGGCGCGGGTG
GCAGCCCGCGCCAAGACGCTGCAGACACTGCTGCAGGCAGCTTTTGCCGGCTGCGTCCACGTGGCCGACATCCGGGGCCG
TGGTTTCTTCTGGTCGGTCGAGTTTATGCAGGACAGCACCAGCCGGCAGCCGTTTCCACGGCGCGTCAACTTTGGGCCGC
ACGTGCAGCGGGTGGCGTTTGACAAGGGCGTGGCCGTGTATCCGGGAGCTGGAACGATCGACGGGATTCTCGGAGATCAT
GTGCTGCTGGCGCCGCCATACATGGCGTCGGACGAGGAGCTGCGCACGGCGGTAGCTACGTTGCGGGAGGCGTACGACGA
GGTGGTGAAGAGCCTAGATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62