GenePrediction:GLEAN_6749 Details

Name: GLEAN_6749
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:239565..238910 (- strand)
Length: 656
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:239565..239485 (- strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_156:239423..239209 (- strand)
Length: 215
Type: CDS
Source: GLEAN
Position: GCSC_156:239132..238910 (- strand)
Length: 223
>GLEAN_6749 class=GenePrediction position=GCSC_156:239565..238910 (- strand)
ATGCTGTCCGCCGTCGCCAAACCGAGGCAGTTGGCCTCGCAGATACTCAACTTTGGCCTGATCCTGTCCACAGCCTTTAT
GGTGCGCCCCGGGTGACCCTGTACCCTGTGCATTAGAAGCATGGCTGACTGACATGTCCCAGATCTGGAAAGGACTCTCT
GTCGTCTCTGACTCGTCCTCGCCCATCGTCGTCGTCCTCTCCGGCTCCATGGAGCCGGCCTTTCAGCGGGGCGACCTGCT
CTTCTTGTGGAATCGCAACCTCTTGCAGGAAACCGACGTCGGCGAGATCGTGGTCTACAACGTTCGCGGAAAGGACATTC
CCATTGTGCACCGGATCGTGCGCAAGTTTGGCACAGGGTGAGTCTGACCGGTGGAAACAGACTGGCATATGAGAACGACG
AGGGAGAACCGCAGCTGACGATCGCCGCCACAGACCCCATGCAAAACTGCTCACCAAGGGAGATAACAATGCCGGCGATG
ACACCGATCTGTACGCGCAGGGTCAGGACTACCTCGAGCGGAAAGACATTGTGGGCAGCGTGGTGGGATATGTGCCGTTT
GTCGGCTACGTGACCATCCTCTTGACAGAGCATCCGTGGCTGAAAAAGGTCATGCTGGGCCTGATGGGAGTGCTCGTCGT
ACTGCAACGCGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62