GenePrediction:GLEAN_6753 Details

Name: GLEAN_6753
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:208549..207716 (- strand)
Length: 834
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:208549..208255 (- strand)
Length: 295
Type: CDS
Source: GLEAN
Position: GCSC_156:207804..207716 (- strand)
Length: 89
>GLEAN_6753 class=GenePrediction position=GCSC_156:208549..207716 (- strand)
ATGACTGGAGGGCGGCCGGACCAGCGAGAGAGCAAGAACAGCTTGGGTTCTGCCTGCCACGGCGACAGCACATCGATCCT
TCCGTTTGCGTCCAAGAGCTGTTTTTCCACCGAGCTCTCCTTGCATGGCTGGGCAGACATGCAGCCAATCAGCAGGAGCG
CCTACGGGCACAAGCGCAACGCCGTTTCGAAGCAGCTGGTGGTTGAAACCGAAGGCAGCCAGCCGTTTATTAAGAGCGCA
GGCTTGGCCCCTGATCGTCCGAGGAGCAGGCAGCGCTGTCTGTACGTCGTACATGGTAAGATACTGGCAATCTGTTTAAC
CCTGCAGCGGCAGGTCCTGTCAGTCCGCCCGAAATTTCCATGGCCCTGCCAGGCCTCAAGCAGCCCATGCTCCACCCGCA
GAGCACGCCACGAGGCCACACGAGCTTTAACCTTTTTGTTTGGCGAGAGCGGTTCGAGGAAGCCGTCCCTTTGTTCCATC
TGGTTCTACGGAGTACGAGTACGAGGGCAGGCGCTTTTGCGAGCGTGACCATGACGAGACTGCGGAATTGACGACTCAAG
AACGGCGTGCGAGTATGGCGGGTGTTGGTTGCAGTCGTGCCTGCCCGTACACTATCTACTTGTTTGTGCCTGCCGTGTTC
ATGCCTGCCGTGTTCACGCATGCCGCTCGTATGTTGCGAGGACGCATTCTGATGCAATGCACGTACTCCGTAATGCAGGT
GCAAATGGTGACTCCGTCTTCGCAGGACCACATTCCGCCCTGCCCGAGCCCACCAATCTCCTCCCCCCACAGCTCAGCAG
CCTGACCTTGTACGGAGTCGGCCAGCCGTGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62