GenePrediction:GLEAN_6754 Details

Name: GLEAN_6754
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:207376..203406 (- strand)
Length: 3971
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:207376..206460 (- strand)
Length: 917
Type: CDS
Source: GLEAN
Position: GCSC_156:206313..203406 (- strand)
Length: 2908
>GLEAN_6754 class=GenePrediction position=GCSC_156:207376..203406 (- strand)
ATGCCAGCCTTCTCCGACCACGACGATGCGGCCTATGCGGCCGACGTCGAGGCAGCCTCACCATCGTCCTCGATGTCCTC
GCCGTCCCGACGCCAGCAGCGGAGCTTGGCGAAAGGCCGTGAGTTCGGCCTGTACGCGAACCGTCTGCGACACCATAACC
CCTCGATGAAACACGAGGGCGATGCTCCCGAACAGCCGCACCAGCCGCACCAGCAGCAGCAGCCGGACCAGGGCTATCCA
AACAGCAACCACAGCAGCAGCAGCGTCAACACCCATCCCAACTCCTACACAAACGAGCAGCTCGACCCAGGCAGTCGAAG
CAACAGCGCTGCAGGCAGAGCATCCAAATCGCCTCGATCGCGAGTCTTTTACGACCGGTCTCCCGCAGCCGAGAATTTTG
ACAACTACGACGACGACGAGGAAGAGGACGTCGAGTCTGCCGACATCTTCACCGCCCGCCCGGTGCAACTGCAGCCGCTA
CAACACCAGCAGGTTCAACAGCAGCCTCACCAGCCGTTCCAGCCTCGCCAACCTCAACAGTTTCAACAGCCTCGCACGCT
CTCGCCCACCTTTGCCGTCTCTCCCATCAGCTCGCCCGTCTCATCTCCCTCACTTCGCTGGGCTTCTCTAGCCCACGGCA
ACGACCACACCTCGTCTTCGATCGACTCGATCGCTCAGCCAATCGCCTCCACATCTTCGGCTGCCACCAGCCCGCGGTCT
TCCACCCCAAAGGCCTTCCGCACCAGCTCCAACAACTCCGGCTCGCGTTCCCAGTCACCCGCTTCAATCAACAGCCGCTT
CCTCGGCCTCAGCTCACACCCCTTTGTCGCCCGGAGTCCGACGCCCGATCGTTCCTCCCCAATTCCACCGTCGACTCTCC
CCTGGCTGCCGGCGGACAGCGGAGGATCATTAACCCAGTCTACGCTAACGGCAACGGCTACAACGGCACCAGCACCAACA
ACTACAACACCAACACCAATACCAACACCAACACCAACAACACCTACAACTACAACCACTACGACAACAACCACCTGCCC
GCCCTTGCCTTTTCTGGCGCCAGAGCCCTGCGCTCGCCTTCTCCCGCTTCCGAGCGGCCTTCGCCCACGACGTCTTTTGC
GTCCGACGGCATGCTCGTTGGCAACTTTTCTCGTCCTCGTATGGCCAGCATTAGCCGCGGCTCGCGCGATGCCCGACCAG
CGCCAATGGGCCTCCACTCACAGCCATCCTGGCCCCAAGAACTTGCCCGTGGCTTCTCGGCCGCCTCCAACCGCTCCGGG
GGCACCTTTTCCCCTCTTCCTCACCGGCCCTCGAACGACCAGCTCCACGGTGGCCGTCACGGTCCCCCCCCCCCGCTACA
GGCTTCCGGCATGATCTCTCCAGGCTTGCCCCGACCACAGGCTGCGTACAGCCGAACTGACGGCATGGGCGGCAGCTACG
GCGCCCACCACAACCAACCGATGCCGCCCCAGGTCAACTACCCCTTCCACCACCAGATCAACCACCAGATCGGCCGCTCA
AACAGCCATCAGAACCTGTACCAACACCCCTACCAGGCCCCGCACACCAATGGCTCCGGCGGCAGTGCCCATGCCCGGGA
TCCACTACCGTGGATTGCCGACGAGGCGCTCCGGTCCAGCTACCGGTCTCAGACGACAAACTCTACCGCGCAGGGAACCC
TGTTCACCGCCACGGGCACAGACCGGAGCAGCATGGCGACAAAGACGAGCTCGCGAGCCTCTATCTCGTGGTACGCCAAC
GCAGCCTCGGGCGGCGACGACAGCCTGGACGTCGACGATGTTATGGATATGTACGAAAAAGGCTTCGCTGACTCGACTGG
CGCTGAGGACAACGCCAAGGATTCGGGAGACGAGGTGCTGACTGACGGTGAATGCGCCATGCTTCCGCCGCCGCTGGCTG
CAGAGGAGGGCAGGGAGCAGTACCTCGTGCGCGATTCCGCTGCATTCTTCCGCAACTCGGGCCTGCCGTCGTCTCTGCCC
GACCATGCCGGCCTCGAGCTTGTGGCCCAGAAAGCAGCGGCCCGGAGGGAGGAGGAGATCGATGCGGACGACAAGTACAA
CATGTACGACAGGTACGACGAGAAGCAAGACCTTCAGCTCGACGACGAGCTCGACGAGAAACAAGACCTCCGACTCGACA
AGGACGACGAGAAGCACTACCTTCAGCCTGACAGCTACGAGAAGCACGACCCGGAGCCGGACGAGTACGACGAACCGGAA
ATCGAGCGGGAAAAGCGCGACTCTGCCAAGATGCTCGAACGGGAGGACCAGATTAAGATGCAGTCGCCTCTGACCGTTGG
GCTGGGCGTCGAAGCTGGCGAGAGCCGTCCTGGGTCGGCCAGGTCGTCCCTCTTCCGAAACGCAACCGAGGCCGAGGATC
CCGACTCCCGCGACCGGTATGGCTTCCGCAAGCAGAACCAGTACATCAGCCGGCAGCAGTACGACTCGTGGAACGGCCCG
TACACAGATTACATCAACCGGCGGCGGCGGAAGTGGGTGGCGTATCTTAAGGACTCGGGGCTGATGACGGAGAAGCCAAA
CCGGTTCCCGCCGCCGAGCGTCAAGACCAAACGGTTCATCCGCAAGGGTATTCCGCCCGAGTGGCGCGGCGCGGCGTGGT
TCTACTACGCCGGAGGCCCCAGCATTGTGGCCAAGCACCCGGGCATCTACGACTGCCTCGTGCGGCGGGTAGCGGCCGGT
GAGGCCAAGGAAGTCGACATCGAAGCGATCGAGCGCGACCTGCACCGCACCTTTCCCGACAACGTGGCCTTCCAGTTCGC
GGACGGCCAGCAGCCCGGACACGGCGACAACCGGGATCTGGATGCGGACGGCAAGCCGAACACGGACCCGACGGCAGACC
GATCGGACGAGCCGAAGATCGTGTCGAAGCTGCGGCGCGTGCTGCTGGCCTTTTCGATCTACAACCCGCGTATCGGGTAC
TGCCAGAGCCTCAACTTCCTGGCCGGGCTGCTGCTGCTCTTTGTCGAGACAGAGGAGCAGTGCTTCTGGCTGCTGAACGT
GATCACGCGCATTTACCTGCCGGGAACGCACGACATGTCGCTGGAGGGCTCCAAGGTCGACCTCAGCGTTCTGATGACAG
CGCTGCAGGATTCGCTGCCCAACGTGTGGGCCAAGATCGGCGGCGAGCTCGACATGGGCGCCGGCCACCCGGGCCAGCGG
CACCAGGCAGCGGCACACGAGGCGGCCAAGCACAGCAACCCACTGGGGCTGCGGATGAAGCTGCCAATGCTGGGCGGACG
GGGAGCCGACGCACTGGCAGCAGCATCGTCGGCGGACCACCTGCCGCCCATCACTCTGTGCATGACGGCCTGGTTCATGT
CCTGCTTTATCGGCACGCTGCCGATGGAGACCACACTGCGGGTGTGGGACATCTTCTTTTACGAGGGCAGCAAGACGCTC
TTCCGGGTGGCCTTGGCGGTCTTCAAGCTGGGCGAGTCGGAGATCCGGGCGGTCAATGACCCGATGGAGATGTTCGGCGT
CGTCCAGGCGTTTCCGCGCCGGCTGCTGGACTGCAACATGGTCATGGAGGCGACGTTCCGACGGCGCAACGGCTTCGGCC
ACCTCAGCCAGGAGAACATTGAGGAGAAGCGGCGGGAGCAGCGGGACGTGTTGAAGGAGGCGAGGAAGCCGGACACGGCC
GACAGCAAAGCGGATAGCGGCAGCATTGTTGGCGGTGGGGGTGGTGGCAGTATTGGTGGTGTCAGCAGTGGCGGTGCCAC
CAGAGACACGACGACGGCAACGACGACGACGGCGACGACTATGGCGACGACGGCGACGACAAAGGGCACGCTTGCCGACG
GACAAAGCGCTGGACGCCTGTTTGCCGGCCCGGATGCGCACGACGAGCTCGGCCAGGATGTGCGCCGAAAGGGGACGACC
CTGTTTGGTCGCTCGCGGCGCGAGCGACGACCGCTGGCCGAGGTGATGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62