GenePrediction:GLEAN_6755 Details

Name: GLEAN_6755
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:199204..192627 (- strand)
Length: 6578
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:199204..199202 (- strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_156:199136..194581 (- strand)
Length: 4556
Type: CDS
Source: GLEAN
Position: GCSC_156:194385..192627 (- strand)
Length: 1759
>GLEAN_6755 class=GenePrediction position=GCSC_156:199204..192627 (- strand)
ATGGTGAGCCCATCCTGCTGCTGCTCCTGATCATAATGACCCCGGTCCACTGACATTTGGTGCTGCAGCCCGCCTTCGTG
GCGATCAACGTCGAGCCCGAGGACAACGTCGAGGACGAGGTCGACGTGACGCGGCGGATCCAGACGGAGGATGCCTTGAA
GCTATACCAGACGGCGCTCAAGCTGCACGCCCAGGGCGCGCGGTCGTTCCCGGAAGCCAAACAGGCATACGACGCCCTCT
TCGAGTCCGAGATCTTTAAATACCCCGATGCAGCGACGGAATACGAACGATCTGAGCAGCAGCAGGACCGGCTGCTGGCG
TCGGGACCGGCCATTGCGCCACGACTCGCACTGGAAACGGCCGCGATCGAGGACAACGCGTCCGAGAGCAGCCTTCCCCA
GACATACTACCTCGCATACAAGAACCACGGCCAGTTTCTGCTGGACCGCATCCGACACAAGGCGCGAGCGGCACGACGAG
CAGAGGCGGAGGCGAATACGGAGACGGATACGGAGACGGACGTGTTTGCCGAGGCGGCTGTGCTAGACGATTCGCATGAG
GCTTTGAACGACTTCCAGGCGGCCCTCGACCGCGATCCGTCGGATGCGGATCTCTGGCGACGGACAGCGCGTGTGGCGGC
ATTTCTGCGCAGCGCACGAATAGAGCGGTACTGCCTCGAGGCGGCCATCGAGCTAGACGATGACCCGGCCGTCGACGAAG
TCGGGCCACCCTCGCTCGCCGAGGGCTTTGCGGGCGAGCAGCTGCGAAACCAGCTACGGGCGCTGGGCGACGACATAGCG
CTGACGCACCCGATCATGGCGCCGTATCTGCGGCGACAGGTGGCGGCGGCGTTGCGGCGGTACCTCGACCCGTTCCCGTG
GCTGCCCAACCGGACGGGCGACACGGTGGCGCTGCCACAGACGGCAGCTGTTGTCCGGCTGACAATCCGGTTCTCGAGCC
CGTCATGGGCCGACCTGGGCATGGCCTTGGTCCGATCGGCGAGCGAGGAGGGCGTCTCGGGACGGGCGATTCAGATCGAG
GCGCCGGAGATGCCGGACGACAACCAGCTGATGCAGATCGAGATCGACCAGCAGCTATCGATGCACGTGTCGCGGCCGGC
GGCTGAGGAGGCGGGTGGGGCATCAGACGAGGAGGCGGCCGAGAGCGGCACGACAAAGGAACACAAGGACAGCCACAAGG
ATCGCAGTACGTCGCAGTCGCGAAAGCGGTCTCAGTCGGCGGCTGGCCTGGTCGAGGCGGCGAACGAGGAGGAGGCGGGC
GGCGACATGAAGCGAAGCAAGCGCATTCGACGACGAGAGACGTTGGCAGGAGAGGCAGTGGACGCGAACGCGACGCTGGC
TGAACAGCTGCAGCCACTGCAAGAGGCCGACTCACATCTGTTTGGGCTGGCGCAGAGACTGCTGACTCGGCTGGGCGTAA
AAGCGTTACCGGCGCTGGACGAGGTGCGGCGAACGATCCAACTGACAGGTACAGATCTGCGCACGGCAGAGCTGCAGAGC
CGAGCAGCACGAGACATGCGGTCGGCGCTGGTCTTCTTCAAGGACGAGCGGGCCAAGGTGCTGCTCAGCAAGAAGGCCGG
GCCGATTCTGGGACTGAACGCACTGCTGGAGCAGTCCAAGGCAGGCCAGCAGAGCGCGGTCGAGGTGGCTACTCTGGACG
AGATGCGCGGGCTGCGAGCGTTTGTGCAGCAGTCGAACAGCGGGTGGCACACGCTGGATGAGGTGGCATACGGGTGGGTT
GGCCAGATGGCGGCAAGCTACGCGACACAGCGCTGGTCGGCGACGATGAAGCAGGCAGTCGTGCAGCTAGTCAGCCAGCT
AGACGGGGTTCTGTACCGGCGAGCATGTCTAGAGGTGGGAGAGTGGGTGGGCGGGAAGCAGACGACGAGGAAGCAGCGAG
AAGACCTGCATGGACTCGTGCAGATGCTGTTTGAGCTCTACCTGGACGTTTACGAGCGGATCAACAACCCGGAGAGCTCG
GTGAGTGAGGAGGTGCGGACAGAGACACGCGACCGACTGGACCGATGGATGGACGTGGCCTCGGGGCTGGCGAGATCGGC
GGCATCAGAAGACGGCAGCACGACGAAAACGAGCAGCCTGACATACCGCTACCTCTGGGCTTGCGTCTTCTCGACGACGT
TGGTAGAGGGCGTGGCACGGGAGCATACGCTGGGCTGCTGGGAGGGCCTGCGGCAGTTTCTATCGCAGCAGAAGCCGGTG
GTCAAGATGGTGATGCCGAACAACGCAGTCATGTCGGAGATCTCGCACACGGCAGCAGAGCGAGAGATCAGCCGGCTGAC
CACGATGGATTTCTTTCTCGGGCTCTTCCAGGAAGAGCTCAAGGACCCGGTGGCGGTGATCGAGACGCTGGAGCCAGTGC
TGAACCCCAGCTCAGTGTTTGTGGGCCAGCGACCGGTGTCGGAGTGTGCAGGGCCAGAGCTGCGCGACTTATGGAAGTTT
CTGCGCGGCAGCAGCACCGATCTGAGGTTGTTTCTGTGGACGCGGCTGGCGGATGCGTACAAGGAGATCGACTACTCGAC
CAAGGTGCTGTCGTGCTATCTGCACAGCATCGAGATGATCGTGGACGATCTGGAGGGGACACCGTCCGAGGCAGCAAGTT
CAGAGGCCAAGCAGCAGGCTCGTTTTGTGCAGATGCTCAAGACGCTGGACGAGGCGCTGATCCAGGCACTGCACCTGGCA
GTCAACGACGCCGGGGCCTTTGACATTGTGGACGAGGCACACCTGCGGACAACGGCGGCAGCGCTGATACGAGCCATCTG
CATGGTGCACGTGGCGCTGATGGTGGAGGACGAAGTGCGGGCAGGCCTGGCAACAGCGGCTTCGGGCTCGCAGACATACC
ACGGCTTCCAGAACCGACTGCACGAGACGTATGTGCGGGCGTGGACGTTGCTGTACGCGGTGTTGAACCGGGGGCTCCGA
GGAACGGAAGTGAAGGGAGAGGATGATGAAGGTGAGGGCGAAGGTGAAGGTGGTGAAGGTGGTGAAGGTGGAGATTTGTC
ATCTCCGTCTGATGCACCTTCCCTATCAGCCCAAATGCAAAACACACTGGCAGAACTGCTGGACGCCATCCACCAGACGA
TCGGACTACGACGGTTCTGCAAGGCGTCCAACAAGATCTTTTTGCGCGTGGCACGAGCCGACCTGCTGCGGATGGACGGG
CTGCTGCACTGGGAACAGCATCTGGGTCAGGTGCTATACGACCTGCACGGGCTGAAGCTGGGGCTGGCAGCCTCGGACGT
GGAGGAGCACGGCTGTCCGGTCGAGCGGCTGGAGCGCAAGAACGCGCTGGCGCTGGTGGACAAGGTGACAGCGCTGGCGA
GTCGGGTGTCGATGAAGGACCTGCTCAAGTCGGAGCTGAAGAACACGATCGAGCACATGCAGCAGGCGATCGGGTCGACC
AAGTCGACGGCACAGATGATCCACAACCTGCGCTACTTTACCGAGTATCTACGGCGACCGATCCATGCACTGCGGCTGTA
CGAAGCATGGCGAGGCGGCGTCGAGCTGGACACGGTGCCAGCCACTACGCCCGACACCGCTCTCGCCCACGGTGGCTGGT
TCTTCCTCATGGGCATGATCGCCCTGACCAAGTTCAAGGGCGTCGACCTGAACCGTCGCCAGACCCCCGGCGCTACCGAC
GACCTGCGCGTCGGCGCTCAGTATTTGCGCCTACAGCTGCAGCTGACCCCGTCACGCTGGGATGCCTGGTTCCGATTGGC
CGAGTGCTCCGATTACGACCTCGATGAGGCCGTCCTCTGGTCGGCCGACAAGATGAACAAGGACCGTGGCGAGCTGGTGC
GTCTGCAGCGCAGTGCCATCCACTGTTACGGCCTCGCCCTGTCGTACTGGGGAGGGGGGGACCTGGCGAGGACAGACGGA
GACACGAAGCCAGACAGCGATGCGCTGCACGACCTCTACGCCAACTTTGGCCAGCGCATGTACGCCAGCAGTCGCGAGCC
GTTTGCCATGGAGGCCTTTGGCCAGGCGGCCGAGAACGAGCGATTCTTCATCGCAGCCGACACCCTGTCGACGTACAAGA
AGGCCCAGCACGGCTCCATGACCGAACACATGGTGTGGAAGTACGCGGCCCGGCTGTTTCGGCGGGCGTTGGGCACCGCC
ACAGCGGCCGTCGTTGCACCAGCCACAGCACCAGCCACGACACCAGCCACCGCCTCAGCCACTTCGCCGCCCGACTGGAA
GAGCGCCTACGTGCTGAGCAAGTGCGTCTGGAAGATGTACCAGACGCCAGCCGTGCTGCTGAGCGAGCGCGAGCGGGCAG
CCCAGCCAGGCGTGTCTGAGGTCGTGCGCGCGCTGGAGCGTACCATTGCCATGGTGGTGCAACTGCCAAAGCCGCGCCAC
GGCCAGGACCCCGTGCTGGAGCCGCACTACAAGCTGCTGTCGGTAGTGGACAAGCTGGTGCGGCGCGGCGACCTGGACGC
GACTGCCGGCGTCGAGATCCTGCAGCGGCAGCCGTACGGGGTCAAGATGGAGGGCGCGGGCGCGGGCGGCGCTGCAGCAC
CGACAAAGGCCGCGTGGGAGGAGTTTGTCATTCGGTCGCTGCGACATCTGCGCGATAAGGACAAGTCAAATTGGCAGCAC
CGGATGATGATTCGCCATGCGCGGATACTGTTTGGGGATTGTGACGAGGAGGAGGAGGAGGAGGAGAAGGAGAAGGAGGT
GGAGAAAGAAGTGAGAGAAGATAAGGAGCAGACTGACGTGGAGATGGAGGACGAGAAGAGAAAGGACGAAAGGGAAAAGG
AGAAAGAGGACAGTGACAGCAAGTCCGAGAACGACAAAAAGTCCGACGTCGACGCTCACAAAGCCGCTATCCGCAAGGAA
CGAGCCAGAGCGGCCTTTGCTGTCTTGCGCGAGTCCATGTTCACCAAGACGATGGTGATGAACGTGTGGAAGTGCGATGC
CGAACGGCCGGGCCGTCACCATGTCTACACCGAGCAGTACGTCCGCTTCGTCACTCGGCTGCTGGTCGTGCTGGAGGACC
GCGTCAACCTGGAGGCGCTGCTGCGACGCATCCGCAAGAAAGGTGCCGACTTCTACCACTTTCCCGACCTCTGGCAGAGC
TGCGTCATCAGCTACCTACGCCTGCTGCGACGCTGCTACGGCATCGCGTCGGCAGCAGCGACGGCCGCCATGGAGGATGT
CTTCAAAGCGGTCACGCCGGAAGAGTTTGAGATTTTAGCCGAGCGCGTCAGTGACTGGGCCGGACAAGAAGTCTCGGACG
GAGGAGGGGATGCTGTGGGCGAGGAGAGAGAGGCAAAGGACGTCAAGGACGTCAAGGACGTGCGGATGCCGAAAGACGGC
GAGATCCAGCCAAGCCCGAAACCAGAACACCAGGCCCTCAGCGCCATGCGCGAGGCGGTCGAGATGAAGAAGCTCAACGG
CAGTCTGATGAAGGCGGGACCGATTGACGATCTGATTGCCGACTGCTACAGCATCGTGTTTGCCGAAGTGGCCCGCGGGC
TACCTGGCGAGGACCCAGCCCGCTTGATCGAAGAACGCCACCGCCAGCAGCGCCAGGAGGCCGAGCGCCTGGAGCGCCAG
GAGCGGGAAGCCGAGGCGTCACAGATGCTGCGTGACTTCAACCTGTTTGGCGACAAGGCGGCCGTAACAGCGGAGACCGG
ATCCAGGTCACGTGCCGGCTCGGAGGGACCGCCTGGGGGAATAACACTACACGTAGCCGAGAAGATGGAGCGCCAGGGCT
CGGGAGTGGGCGGAGACAAGGATAAAGGTGGCGCCGACCATCCGGTCCGTCGAGGCCGTGCAGCTGGGGTTAGGCGACCC
GATGTGCTGCGCAAGGCCGAACAGGCGGCAGCAAAAGCGGCAGCAGCAGCAGCAGCGAGAGCTGGCGTGACGGGAACAGG
CGTGACGGGCACAGGTGTGATCGGGACAGGAGTGGCCGCTGGGAGTGCAGGAAGTGCAGCTGGGGGAGGAGCAGGGATCT
TGACGTCCGCAGCAGGCGCATCGACAACAGCCACAACGACTGCGACTGCACGTGAAAACAACGGCAGCGGACGGCGATCG
ATGCGGCTGGGCTCAGCATCGAGTGCGAAGAACGAGGCCGGTGGGGTCGACGGCGACGGTGACGATGGACGGGGTGAGGA
AGAGGTCGAAGCAGAGGCGGATGGCCCGGAAGACGAGCCGGATGGCCGTCGTGGTCGACAACGGGGCCGAGGACGAAGCA
CGCGGAGCAAAAGTCGACTTAGTCAGCAAGAGGAAGACGGAGAGGACGGAGGACACGGAAACGGAGACGGAGACGGAGAC
GAAAACGGGGATGAAAACGGAGGAGAGACGGCCGAACACTCGCCCGATCCGGACCATGGCCATCTGCTCAGCCCCCACAC
AGACACCCACACGCCCAACCCGCACAGCTCGGCAGCATCGTCGCCGGCCGGCAGCGTGCATGACTCGGCCGACGACGAGA
GCGAGCTGAGCGACGTGCCGGCAGACTACGACGAGAACGTGCCGGCATCACTGCTGCTGCTGCCAGAGGTGGAAGATGTC
GACATGGTGGAAGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62