GenePrediction:GLEAN_6757 Details

Name: GLEAN_6757
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:183645..181559 (- strand)
Length: 2087
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:183645..183591 (- strand)
Length: 55
Type: CDS
Source: GLEAN
Position: GCSC_156:183523..182909 (- strand)
Length: 615
Type: CDS
Source: GLEAN
Position: GCSC_156:182861..182787 (- strand)
Length: 75
Type: CDS
Source: GLEAN
Position: GCSC_156:182724..181559 (- strand)
Length: 1166
>GLEAN_6757 class=GenePrediction position=GCSC_156:183645..181559 (- strand)
ATGGCTTCCCAGCCAGAAGCCTTAGAGCTTCTCGACCTCGTGGTCGTCGGTGCGGGTAAGCCTTGTCTCCGTGGCACAAG
ACCCTCTTTCAACATCTCCCCTCTCGCTGACTCCCCGCAAAGGATGGTTTGGCATCTCTGCCGCCAAGACCTTCTGCCAG
CTGCATCCCGATGCATCGTTTGCCGTGCTGGACGCGGCCGCCACGCTCGGTGGTGTCTGGGCTGAGCACCGCCTGTACCC
CGGCCTGAAGAGCAACAACATGCTGGGCACGTACGAGTACCCTGATATGCCCATGGATACCGCAACGTACGGCGTCCAGC
CCGGCCAGCACATTCCCGGTGCCGTCATCCACCGCTATCTCACCGACTATGCCACCAAGTTTGGCGTAGCCGCTGCCTTC
CGCAAACGCACAAAGGTCCTTTCAGCCGAGCTGCGCGACGACGGCGGCTGGACCCTGTCACTGCTCACCGATGGTGATGA
TGGCGAGTCCTCTTTCTCGACACTCGCAGCCCGCAAGCTTATCGTAGCCACCGGCCTGACTTCCGAGCCCTTCCTGCCGC
ATTTTGCCGGCCAGGAGACCTTTGGTTGCCCCATCTTCCACAGCAGGGACTTCTTGCAGCACGCAGACTCCATAGAGACT
GCTAAGAACATCACCGTCTTCGGTGCCACCAAGTCTGCTTGGGATATTGCCTATGCATACGCCTCTAAAGGCGTCACTGT
CAACATGATCATTCGCTGTATGTTCCTCTGATCTTGCCCTCCCGGCCAATGCTGACAGGACCAGCCACCGGCCACGGGCC
CATCTGGCAGGCACCACCATATGTCACTCCGCTAAAGAAGTGGCTGGAAAAGCTCGTTAGTAAGTCAAGTTCTGAAACTC
TCCCATCCTCTGGCCTCAGGCCTCAACTCACACATTCGCAGTGACCCGCATGCTCACCTGGTTCAGTCCTTGTATCTGGG
GCGACTCCGATGGCTATGCCGGCGTCCGCGGCTTCTACAGCAACACCGCCGTCGGCCGCAGCATTGCCAACACGTTCTGG
TCCATCCTGGGCAGCGATGTCGTGACGCGCAACAAGTATGACAGCCACCCGGAGACGGCCAAGCTAAAGCCCTGGAGCCC
GGCCATGTTCACGGCCTCTTCCTTCTCCATACTCAACTATGAAACGGATTTCTTCGAACTGGTCCGTAACGGCAGCATTC
GCGTTCATATTGCAGAGGTTGCCAAGTTGGAACCCGGCGTCGTCCACCTGACCGACGGTACCCTGCTTGCGTCCGACGCC
CTCGCGTGTGCCACTGGCTGGAAGCATGTTCCGCCGATGACCTTCTTGCCCAAGGGCATCGAAAAGGACCTGGGAATGCC
GCACGTCGTTGCTGCTAATGCTGATGCGGACGAGCCGATCGTGACCACGGCTGCGCTGGACCGCGCCGACAAGGAGATCC
TCCGCCGTTACCCTCGCCTGCGCCAGCAGCCCGTGCAGAACAAGAACCTGAAGCCCATAACAGAGTCTGGTGGCGTGTCC
AGCAGCAGCCCCGAAAGTAACTCGCCCCCGGCAAGTGCCCTCGCTCCCTGGACGCTGTATCGGTTCGTGGTCCCACCGAC
CGAGCGTTTCCTGCAGCGACGCGACATCGCCTTTGCGGGCGTCATCATGAACTTCTCCATTCCTACCATAGCCCACGTGC
AGGCACTATGGATAAATGCCTTCTTCGATGGCGCGCTGTCGCCAAGCGTGCTGCCGCTGTTGCCGAAAGAAGCTGCGGTC
GCTGGTGAGGACCCCATAAAGGCGAAGGCGGCTCTTGAGAAGCTGCGCTACGACACGCTGCTGTACAGCCGGTTTGGCAA
GTGGCGGTATCCGGCCGGCCATGGCTCGCAGTTCCCCGACTTTGTCTTTGATGCATTGCCATATCTGGACTGGTTAGTGG
GCGACCTGGGTCTGCGCGTCCACCGCAAGGGTGGTTGGCTGTCCGAGGCGACGACGCCATATGGACCTGAAGAATACAGG
AATCTGGTGGCAGAGTGGCAGGCCAAGCAGGCCAAGACGATTGAGCTTACCAAGCTGGCCAAGCTGATGAGCCAAGAAAC
ATGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62