GenePrediction:GLEAN_6759 Details

Name: GLEAN_6759
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:177578..176328 (- strand)
Length: 1251
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:177578..177393 (- strand)
Length: 186
Type: CDS
Source: GLEAN
Position: GCSC_156:177266..176709 (- strand)
Length: 558
Type: CDS
Source: GLEAN
Position: GCSC_156:176657..176328 (- strand)
Length: 330
>GLEAN_6759 class=GenePrediction position=GCSC_156:177578..176328 (- strand)
ATGAACGAATTAATCTGGGTCAACGTGTCGCCTCGAGTAGACAGGTCAAAAGTCGAGTTGGCCGAGACAGCCTGGCATTG
CGGCGCACAGGGCAAAAGTTTTGATACTGGCATCAAAAGTGAACACGACAGTGATGATACCTCCCTCATTGATCCTGCGA
TTCTGTATCCGCCGCCCCCTGAAGCAGTGCGACTAGATGCAGTTCCGGCCTCAGGCCTGAAAGCCTGTACATCTTTTGAT
AAAGGCCTTCATGTCGGCGACCACAATAGCCAGGAGGCAATTGTCTCCGAGTCTGCGCATTCCCTGGATTAGGAGGCCGG
GAACAGCTCGGAAGACGGCACACTGTTCCACGGATTTTTGGACATCGAAAACCGGGACTACTACGATGATGGTAGGCTTA
GAGAGGCTGGTATTTCGGCAGCCTTGTACAGTTCCGAACCAGCAGGAACGGCAGAATCGGATTACGACACTCCCCACTCG
CTCGACGACGATGCCGGCAATGCTTCTTCTGCTTACCCGTCGGCTCCTCTGAACCCGACACAGCCACAGATTGGCTTGCC
AGCTGTCGGGGTGCAGCAAGAACACTGGCCATACCCACAACCTGTTCGGCCAGCAGACACGCTTCACCAGTACTACCAGG
ATACGCGGCTCGTGACACGGGCGGGACAGCAGGGCCGTATCCGGCGTCGTCAGCGTTCTTCCGTGAACCAGAACCATCCG
CCTGGATTGCTGCCGCCTTGGCTCATATCTTCCTACCGCTCAGCCAGCCTGACACACCACAAACCTCTCACGGCTGCGTG
GGCCCAACACGAGCTCGACCTCTTGGAGCGAACGCCCCGGTCTGAAATCGACGACGCATTCCGTGACCAGGTAATCATTT
CCTTCTTTTTCTGGCGGTCACCCAATTTCTGACGATTCAAGCACTTTCCCGACCGCACGGATTTGGCTGTCAGCGCAAAG
TGGCTGGAACTGTGTCGCAACCGTCAGCACCGTCAAATCATTCTTTGGAAGAGAGAGGCAGAGGCAGAGGCTGCACGGCC
TCTGCCGGTACGAGGGCCCATGAGCCCCACAAGCCCCATGGGCTCCACAGCTTCCACCGACCAACAGTCCCCGCCGGCCG
CAGGCAACGAGCCAAGTGGCGAGAAAGGCTCGGACCGTGAGGAAGAAAGCAACGAAGATGCCAAAGACGAGGACACCTGT
CCGGATGAGGTCGGTATGGATGATGCTCCGACTGCAGAAGACGAGCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62