GenePrediction:GLEAN_675 Details

Name: GLEAN_675
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1380617..1381864 (+ strand)
Length: 1248
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1380617..1380947 (+ strand)
Length: 331
Type: CDS
Source: GLEAN
Position: GCSC_97:1381011..1381864 (+ strand)
Length: 854
>GLEAN_675 class=GenePrediction position=GCSC_97:1380617..1381864 (+ strand)
ATGAGGCGCATACGTTCACAGCTCTGTCCAGGAAATCGTTCGGCCTGCGATCGCTGCCATGCCAAGAAGCTAAAGTGCTC
CCGGCTAACAGACGAGCTACGCTGCAGCAACTGCGAAAAGGACGGGCCCCTCTGCATCCACAGCCCGCCATTGGAGGGAG
GCCGGCCTAGGAAGTGCAAGCTCCCGCTTTACGAGAGCCGAAGCGAACAGACAGACCCACCGGACTTGTTACATTTTTAT
CATGCCGGCAACACTCACTTGGATCGGAGCTCCGGAGAGCAGGACTCTATGGATGGCACGGCTGTACCGGACATGAACTG
GAACAATGCCCGTACGTGACAATTGGGACAAGTACCATCCGAAAAGAACAATGATGACTGATTCGCCATTTCAGCACTCC
TCTCCGACCTGTTCTGGCGGCCGTGGTTGATGCTCGACTCGCCACCAACAGAGGGTGACATGCAGCCAGAATCATTCGGA
GAGCCAGACGTCGCGTTTCAGCACGACAAAATCTTTGGCTTCGGGGAACACAGTCAACATGCGAGCAGCAAAAGCAATAA
CAACATCAGCACGACGACGAGCACGACAGCAAGCATGCCGACGACGGACCTGGATCGACTACTGGGTCGGCTGGCAGGCT
TGCAGCAGCAGCTGATGTTGGCAAAGTCGGCTCTGTCCCCGGTCGCGGTACCACACCAGGACGGAGATGGCCTATTTCCG
CACGGTGGCTGTCCGCGCTTCTCCGGGCTCGCGGCCATGGAGCCGGCACTTAGGCTCGCTCACGCGATGCTTGCAGTGGC
CATGCCAGCAACGCTAACGCTAGATCTGTACCGGGATGCGCTTCAGCGGGTAACGAGCGAGCTGCAGCCGCAATCGCACC
CAAATCCATGGGCCGTAACGCCGTCGGGAAGAAGCAACTCCATCAGCATCAGCCCAACTCCGTCTTCTCTCTTCGAGCAG
CAGCAGCAGCAGGCACAGCGGCAGGTCCCGCAGGTCCCGCAGGTCTGCTTGGCCGAGTGGTCGATGGCACGCTTGCCTGA
TGATTTGAAAGCATTTATATCGCTGGCCACACTACAGTACTACCTTGTTCAGATGGAACAGGCCACGGCTGCGGGGGAAC
AGGCTTTATCTCCGAGCGAGAGCGGTGGCTTACCCTTTATCGCACTGTCGATCCAGCAGCTGGCGTCTACGGTGCGTAAT
ATACGAGACGTGGCGGCGCAGGTCATGCACAGAGTGCTGCATTGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62