GenePrediction:GLEAN_6760 Details

Name: GLEAN_6760
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:175529..174279 (- strand)
Length: 1251
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:175529..175494 (- strand)
Length: 36
Type: CDS
Source: GLEAN
Position: GCSC_156:175389..175155 (- strand)
Length: 235
Type: CDS
Source: GLEAN
Position: GCSC_156:175078..174279 (- strand)
Length: 800
>GLEAN_6760 class=GenePrediction position=GCSC_156:175529..174279 (- strand)
ATGAGCCACGATAGCACATACGCAGAGATTCTGCTTGTAGGCATTTGTTCTTTCTTTCTTCTGTCCCTATGCTGTATTTT
TAAGTGATCGGCTTACTGGCTTAAGCAGACTGACGGTGACTGACTCTGGAACACCTGCAGGCCGGCGCCTTCGCTGCCTT
TACTGTTGACTTACTGGTTTACCCTCTCGACACGATCAAAACCCGTCTGCAGAGCCAGGACTACATCAAGACCTACGCTT
CTCCCTCTTCACCGGCGACGCCATCTGTGTCATCCGCCACTGATGCCGCCTTACGCCGCGCCATCCGGTCTCCCTATGCC
CTACGCGGTCTCTATCAGGGCGTCGGCAGCGTTGTTGTTGCGACGTTACCAGCCTGTAAGTCTCCTCCGGTCCATTTTTT
CAGCAGCCCTGGTTGTCTCCTATTTCCTGACTCAGCTGGCCGTCGGAACAGCTGGTATATTCTTCAGCACTTATGAGTCA
GCAAAGCTCGTAGTAGGCAATGTGCTGCCAAACGCGGTGAATGGCGGCAAGGCACCTCCGGCCGCTGTCGTGCACTCGTT
ATCGTCCGGCATAGCCGAGCTGGCATCGTGCCTAGTTCTCACGCCGGCCGAGGTAATCAAGCAGAATGCACAGATGATCC
AGAGGGCTGCCACCGCATCTGCCGCCACGACCACCACAATCCCCAAAACATCTGCCATCAAACCATCGATGAGCAGCTCC
CTGCAGGCGCTACAGATGTTGCGCAACGCAGAGGGAGGCGCTTCCCGACGGCTGCTGTCCGGCTATTCGGCGCTTGTTGC
CCGCAACGTGCCGTTCACAGCGCTGCAGTTCCCCATGTTCGAGGCCATGCGCGTGCGCCTGTTGGCACGGTGGAGCAATG
ACTATGAACACGGCGGTGGTAGCAGCCCTGACCGTGTAGGACAACTGCTGCTAGTAGGCGCAGCCAACGGCTTGAGCGCT
GGCGCATCGGGAGCCGTGGCTGCCGTGGTCACGACGCCGTCAGACGTGATCAAGACCCGCATGATGCTGTCGGCAGGAGC
ACATTCCGACAAGCAGATGCATCCCCAACACAAGAACGCCCTGCAGCTGACGCGGCTCGTCTACCACGAGCACGGCATGC
GCGGCATGTTCCGCGGTGGAGCGTTGCGGGCAGCCTGGACCTTTGTTGGCAGCGGTCTCTATTTGGGCACATATGAGATG
GCCAAGGCGTGGCTGCGAAATGGGCGCGAATCCGACGATGCCGGATTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62