GenePrediction:GLEAN_6761 Details

Name: GLEAN_6761
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:173235..172166 (- strand)
Length: 1070
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:173235..173033 (- strand)
Length: 203
Type: CDS
Source: GLEAN
Position: GCSC_156:172892..172166 (- strand)
Length: 727
>GLEAN_6761 class=GenePrediction position=GCSC_156:173235..172166 (- strand)
ATGTCAACAGGCGAGTGGGCCGGCGACCAGAGCAAGAACGCCATCCTGTGTCGAGAGCACAATCTCTGCGCGCCGGAAGT
GGGACGACGGAGGGCTGCTGGCTGGCCTGCGCCCAACCTGAGCGCAGCAGTCGTCCTCAAGTTGCCGCAGATGGCCGCTC
GAGATTTCGGCAACACCCTTACTGTTGGCCATCTGCTGCTCCCGTCGGTTTCCGTATTCCGTTTTCTGTTCTCTAATCCC
CCCCTCTCCCCCTGTATATGTTCTTCTCTCCCACTTGTATTTGCGTGCCAAGATTCCCAAAGATTTCTCAAGACCGTCTT
GGACCACTTCACGTCCTGTCCAGATCCAACACACCTGCAAACCAAACCATACCTCTTCCAACAATGGCCACCACCGTGCA
GCCTCTGTCGTCAGCCAACATCAGCCACAGTCATGACTCGTCCGATGAAAAAGGGGCGCTGGCCCTCACAGAAAGCATCG
GCGGCAACAGCACACTGGTGCCGTCACTTGACGACTCTCGCTATATTGCCATCTCGCCCTACCCAGACCATCTGCTGGAC
CTCGACACACTCGACCCCCAGACAAGGCTGCTGACCCGCGCCCTGACCGTCTTCGACAAGGTCCGTGACGACTACGCCAC
GGCACCCTATGCAGACTCGTTCAACCTGTCTTCCGTCATCGACCTCCTCCGTCGGCTCGTAGCAGCCAAGGTGCCAGAAG
GCTTCCGCTGGCAACGCGCCCACTTCTTCGTCGTCGGCTTTCGCTCACAGATCCCGCCCGCCACTACGTATAGTGATCTG
GACCATCTCGACGTGGCCGCCCACCGCGAGGCCCTGGCTAGTGGCGGCCTGATCCGGTACTGGTTCAACAACCCCGACGC
CAACGGTCGCAATCTGGCAACATGCGTGTGGCGGTCGCAGGCCGACGCTCGCGTGGCCGGCCGCGGCCGCGAGCATCAGC
GGGCCAGCTCGGCCGTGCGGTCGCTGTATAGCGAGTGGCATATCGAACGCTACCGGCTGGACATTCATGACGATGTCAGC
CAGTGGGAGATTGGGGAGTGGACGGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62