GenePrediction:GLEAN_6762 Details

Name: GLEAN_6762
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:171294..170108 (- strand)
Length: 1187
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:171294..170732 (- strand)
Length: 563
Type: CDS
Source: GLEAN
Position: GCSC_156:170669..170108 (- strand)
Length: 562
>GLEAN_6762 class=GenePrediction position=GCSC_156:171294..170108 (- strand)
ATGGTTTCTGTGGCAGACGCCATCAAGGACTCGCCTTTCCAGGCGGTCCAGGTCGAGGCCCTGGTCGTCATGAAGATCAC
CAAGCACTGCTCCTCGACCTTCCCCACGACGGCAACCGGCTCCATCGTCGGCATGCAGAATGGCAGCACGCTCGAGATCA
CCAACACGTTTGCCTTCCCGGCCCAGGACGCAGCCAGCCTGGACGGCGCCACGTCATCCAACGACCGCGGCCACCAGAAC
GATGTGTCTGCCCTCGCTGCGGCCGCGCCGCGGTCCAAGGCCAATATCGCCTACCAGGCCGACATGATCCGCCACCTCAA
GGAGGTCAACGTGGACGCCAACAACGTCGGCTTCTACACGAGCGCCACCATGGGCAACTTTGTCACCATGAGCCTGATCG
AGAACCTGTATCACTACCAGCGTGATGCCTCCACCGGCGAGAGCAAGGCCGCCCTGGTCTACGACGTCAGCCGCAGCTCG
CAGGGTGCCCTGAACCTGCGCGCCTTCCGCCTGACCAACACCTTCCTGGCCGCCTACAAGGAGGGCAAGTTCACGACTGA
GAAGTATGTGCCCTCCCGCTCTTCTCCCCTCTTGTCTTGCTCTTTACGCCTGCTAACCCTTGCAGCCTGCAAAAAACCAA
GCTCACGTACAAGGACATCCTGGTCGAGCTGCCCATTACGGTGCACAACTCGCACCTCCTGACCACCTTCATCCACCAGC
TGCCAGCGCCGCCTGATAGCGCCGAGGTCGCGCTGCCGGCATCGCTCTCCGATATCCAGCGCAACCCGGTGGCTGTGCCG
CCGTTCCCGTCTCTGGACGCCCTCGAGCTGTCCATCGACCCGTTCCTGGAGAAGACGTGCGACCTGCTGCTCGACAGCAT
CGAGTCACACTACACCGACCTCAACAACCACCAGTACTACCAGCGCCAGCTCACCCGCGAGCAGCAAAAGATCACCGCTT
GGCAGACCAAGCGCAAGGCCGAGAATGCCCAGCGCGTCATCGCCAAGCAGCCCGCCCTGCCCGAGGACGAGTGGCAGCGG
CTCTTCAAGTTGCCCCAAGAGCCCAGCCGGCTCGAGGGCATGCTCAACGCCCGCCAGGTCGAGCAGTACAGCCGCCAGGT
CGACGGCTTCACCGCCAACGTCAGTGCCAAGATGTTTGCCGTGCGCGGAAACCTGCTGCCGGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62