GenePrediction:GLEAN_6763 Details

Name: GLEAN_6763
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:169297..167814 (- strand)
Length: 1484
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:169297..168397 (- strand)
Length: 901
Type: CDS
Source: GLEAN
Position: GCSC_156:168335..167900 (- strand)
Length: 436
Type: CDS
Source: GLEAN
Position: GCSC_156:167826..167814 (- strand)
Length: 13
>GLEAN_6763 class=GenePrediction position=GCSC_156:169297..167814 (- strand)
ATGTCTGCCCCGGCTTCGACCTTCAAGGTTGCCGACATCTCGCTGGCTGCCTTTGGCCGCCGCGAGATTGAACTGGCTGA
GAATGAGATGCCCGGTCTGATGGCCACCCGTGCCAAGTACGCTGAGGACCAGCCGCTCAAGGGTGCCCGCATTGCCGGCT
GCCTGCACATGACCATCCAGACTGCTGTCCTGATCGAGACTCTGGTCGCTCTCGGCGCTGAGGTCACCTGGTCGTCTTGC
AACATCTTCTCCACACAGGACCACGCTGCCGCGGCCATTGCTGCCTCGGGCGTGCCCGTCTTCGCCTGGAAGGGTGAGAC
CGAGGAGGAGTACAACTGGTGCCTGCAGCAGCAGCTCATTGCCTTCAAGGACAACCAGAAGCTGAACCTGATCCTGGACG
ACGGCGGTGACCTGACCCAGCTGGTGCACGACAAGTACCCCGAGATGCTCGAGGGCTGCTTCGGTCTGTCTGAGGAGACC
ACCACGGGCGTTCACCACCTGTACCGCATGCTCAAGAACAACAAGCTGTTGGTGCCCGCCATCAACGTCAACGACTCCGT
CACCAAGTCCAAGTTCGACAACCTGTACGGCTGCCGTGAGTCCCTGGTCGACGGCATCAAGCGTGCCACCGACGTCATGA
TTGCCGGCAAGATTGCCGTCGTTGCCGGATACGGCGACGTCGGTAAGGGCTGCGCCCTGGCTCTGCACGGCATGGGTGCC
CGTGTGCTGGTCACCGAGGTTGACCCCATCAACGCTCTGCAGGCCGCTATGGCTGGCTTCCAGGTCACCACCATGGAGAA
GGCTGCCCCCATCGGTCAGATCTTCGTGACGACCACCGGCTGCCGCGACATCCTGGTTGGCAAGCACTTCGAGGCCATGC
CCAACGACGCCATTGTCTGCAGTACGTTTCACTTCTTGTATATATAGACCCTTTTTGAAGACCTCTCTGCTGACCAGCCT
AGACATTGGCCACTTCGACGTTGAGATTGACGTTGCTTGGCTCAAGGCCAACGCCGCGAGCCACACCAACATCAAGCCTC
AGGTCGACCGCTTCACCATGAAGAGCGGCCGCAACCTGATCCTGCTGGCTGAGGGCCGTCTGGTCAACCTGGGCTGTGCC
ACTGGTCACTCTTCGTTTGTCATGTCGTGCTCGTTCACCAACCAGGTTCTGGCCCAGATCCTGCTGTTCAAGAACAAGGA
CGCCGCTTTCTCCAAGAAGTACGTTGAGTTCGCCAAGACTGGCGCTCTCGAGAACAAGGTCTACGTCCTGCCGAAGATCC
TCGACGAGGAGGTCGCCAAGCTGCACCTGAGCCACGTCAACGCCGAGCTGAGCTCCCTGACGCCGGTGCAGGCCGAGTAT
CTCGGTCTGCCCATTGAGGGCCCTTTCAAGTCCGACATGTACGTTCTTTTATCTCTCTCTCTCTCTCGGCATTGTGTCCC
CTTTCATGTATGCTGACAGCTCTGGAAACAGGTACCGCTACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62