GenePrediction:GLEAN_6765 Details

Name: GLEAN_6765
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:162128..158972 (- strand)
Length: 3157
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:162128..161029 (- strand)
Length: 1100
Type: CDS
Source: GLEAN
Position: GCSC_156:160800..160794 (- strand)
Length: 7
Type: CDS
Source: GLEAN
Position: GCSC_156:160413..159939 (- strand)
Length: 475
Type: CDS
Source: GLEAN
Position: GCSC_156:159876..158972 (- strand)
Length: 905
>GLEAN_6765 class=GenePrediction position=GCSC_156:162128..158972 (- strand)
ATGGCGCAGCTATTGACTCGCCCACCACCTCATCCAATCGCAACCTCTCTCGGTACCAGCGTCGACGACAGATACCACCA
GCTCGGAGACGAGGACCCGGCCAGGAACAGGGACAACGTCCGGCAGGAGGTAGAGGCGCAGGCATATGGCCACCTGGGAC
GACCGGCAGCAAATCTGCGAATACGAGCTGCCGGCCCAGACGACCGACACGAATATGAATATCAACAGCCTCATCGGCTG
CAGCTAGCACATCGCGAACGACACGCGGTCCACGCCGGGTCAGACTCGTCGTCATCCTTTCGGTCATCTTCGTCTGGTCC
GCAGCACTTGCCACCATCTAGTCCCGTGAACGTTCCGCAAGCATCCGCCGCCGTCCCGTCCATCCTTCACATCACCAACA
CCACTACTCCCGCAACTATCACCAGTGCCGCTCTCACATCCATGGGTGCAGCCGCTACAGGCTCACCAGCATCACGACCA
CCGCTGCAAGCACGGCCGCCGTCTTCTGTCCCTACCCTCGAGTCTCTGCCGCCCATTCAGCCGCTGCAAGATTCGGACGA
CGACCAACTGCACGACTTTCCCTATCACCAATCCCCCGCATACAGTACCGGCCGCGGCTGGCTGCCATACACTGGCACGT
ATCCTCACTCCGCCAGCACCGAATCCTCCTTCTCCGTCGCCTCGTCACAGCCCGACAACATGTCGAACCAACCCCCTCAA
CCGCCGGGACCGTCTCGTCTGCTGGGTGCTACCGGCCTTGGACACTCCAGCTCGCCGCCGTTTCCGCGGTCGTCGAATCA
GAACCAAGGCCAGAGCCACTACGCTTACCCTTCTCATGGCGGTGGCAACACGTCTGGAGGGCCCGCCTCCCATATCGGCG
TCGGCATCGGCGACCTGTACCGACAGCCGTCTGTCGGCGAGCCGATGCATCACTCATCCCATCTGCCAAGTATGCGAACC
ATCGACGTGCACCAGCCGCCGCAACCGCAACTATCGCACGGAATGTCGTTGCCAGGACCGGCAATGGTGCAGACGGCACC
GTCCTCCTACGTATCCATGCTGCCGCCGCCATACTCGATGCCTTCGCACAACGTGCCGATGTATGGACTGTCGGGGCAGC
CGAGGGAATACCACAACTACCGGATGGCACCACTAGGCATGAGCCCAGTCCCACGGCATAAAAAGGCGAGCTTCTCATCC
TCCATTCCATATTGGCCCAGGCCGTAGGCCGGTAGCCAGATAGGAAGACGCACGCACTAACGTCACGTACGAGAGCAGGA
GATCAAGCGACGAACAAAAACCGGCTGTATGACATGCCGAAAGCGCAGAATCAAGGTGAGTTTGGCCACCATACACGCAC
TTCGCAGCATCAATACCGCATCCCCTACCACACTTCCTGTTCCTGTTCCTGTTTCGTTCCTTCCCGGTCGCACATAGTAT
CTGGGCAGCCGGCCTGAGTGCAGATGGGAGCCCTAGGAAACACCACAGCGGTGGATTTGGGCAGCCGATAGACTGGACGA
GAAAAAGCGAGACAGTCCAGAACCGGTTATGCCTGCGGGGGCTCTACAGGCAGCTGGTACGCTAAAAGCGTGCCTCACCG
CCCGGCGCTAATTCCTTCCCCGTAGCCCCTCCAAGGGCAATCCACTGACCCCCGAGCGAATTATTTGTCTTCTCTCCCGA
ATTGCAACTAACACAATACTTCTCATCATCGACAGTGCGACGAGACACACCCCACCTGCAACAACTGCAAGAAATCAAAG
CGCGAGTGTGCTGGTTACGACCCTGTTTTCAGGCAGCAGCCGCAGAGTCCCGGAGCTCTGCAAACGGCGACACAGTCACC
AGCTTCTGTCTCCTCTGGAACTGCCGTATACTCTTCGATCTCCATATCACCTATCGCTGCCGCTGCTGCTGCCACCGCTA
CTGCTGCCACCTCCAGCACTGCGTCGACGCTTGCGGCCGTAAAGTCAGCTTCTGCCGGTGTCGCACCTCCTGTGCCGTCC
TCGTCCTCGTCTACGCCGACCTCTACATCGAGCATCTATGCCGTTACAGCCTGCTCAGCATCCTCTAGCAACTCTTCGCT
AAACGCCGCCTCTACGGCGTATCACCCGGCAGCCTACGTGTCTCGGTCCATTTTGTCACCGACCCAGGACTGGAGCTACG
CGCCTGAACCCACCGGATCGGTCTACAGAGGTGGGTTGAACCGCTGTACGCAGCCATAGCTATTTCAATTCCCACTGACC
TGGACCCCCCAGCAAAGATGAAGGTCGATGAGATTATCGGCCTAGCAGGGCCCGCTCCTCCCGTGCCAACAACACAGCCC
ACTCTCGAAACTCTGGACGACATCACTAAGATGTACTTTGAAATTTACGTCCCTGGACTGACAACCTTCTTTGAGACAAC
CTGGTACAACTTCAAGTCGAACGGAACGGTCAACCCGGTGAGCAACTTGCTGAACAACAAAAATCTTGTGGGACTGCTGT
CGGCGTTCCTGAATTCCATCGCCCGGGTCGAGACGGCGGATCCGAACGATGCCAACATGATGGCGGCATCAGCCCTAGAG
ACACGCATTGTGTGGGCACTAGCCGCCATGGCCTATGTAACACCGGCCACGGTCAACCTGCCGAGCGAGGAGCCGCTTTC
AACAGATAATGCCACTGAGGCGCGCAATCGACTGTCCGTGATCGATGCGCTGCTCTCGGGAGGTTGTGTGCGAACAAACC
CGTGCATGCCGCCACCAAGAGGCGGGAATCCTACCCGGATTCGTGAGCACCAGTTCTGGTGGTGGTTGGCAGAATACCTG
CGGTTGCAAGAGGATGCAGGCCTCAACAACACACCTGGCAACAGCCTGCCGAGGCTGCGCGAGCAGGCACTGGTGCGGAT
GCGAAACCTGCTGGATGGCCACGAGAATCGCGACATTATCTATTCCATTGCCATTCTGCGCCATCTCGCGCCACGCTACT
CGGCTTCCAGCGACATGATTGTCCCACCCGGCCACGAGGACGAAGCCGATCCGCGCATCAAGTTTGCCATGGCGACGGAG
TTCATCCGCAAGCAGGCGCAAGACCACGGCGCCGGCTTGACCAATGTGGGCCGACGCATCGCCGACATTGGCCTCAAGGC
TTTTGTGCAGCCGGGTTACAGTATCCGACGGGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62