GenePrediction:GLEAN_6766 Details

Name: GLEAN_6766
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:157690..156479 (- strand)
Length: 1212
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:157690..157610 (- strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_156:157344..157110 (- strand)
Length: 235
Type: CDS
Source: GLEAN
Position: GCSC_156:157029..156479 (- strand)
Length: 551
>GLEAN_6766 class=GenePrediction position=GCSC_156:157690..156479 (- strand)
ATGAGCCTTGGAGGGCTTTCTCGCATTCTGGCACGAGGAAGAGAAGGAACAGAAAGTCCGGCCAAGGGGAAAATAGAGAG
TGTAAATAATTCAAAGGCATCTCTGACCGACACAGATTGGACCTCTTTCTTTTCCAAGCTGATGACCCAGCAAGCAGAAG
CATCGCTATCTTGCAACATCTGCAGCTCCAGCCAATCAGATTACACGCTGTCTGCTAGCTGCGATACCCCACTTAATCGA
TCATTCCACTCAAAGCAGGCTGGACATTTTTAAGCTTTCTTTCACAGGCATGCACGGTTTTCTTCCCCTCTCGCCCCCCA
GCACTCTTGGCTCCCCGTGACGGCAGCTTCATACCGCCGCCCTGGCGAACCTCTTCTGGTCTTCGAGCAAGCCGGCGTCC
CAGCCGTCCCCGCCGACCCGGCCGACCCGGCCTTCCCGGCCGTCCTCAGCCTCTGCCGACGAGGACGACATTGCGGACGA
CATCGCGGACGCCTCCTCTCGCGATAATCCCACCATGGCGACACAGCCTGCACGTCCGGCACTAACGCCCCAGCTCTGCT
TCTCCACGGTCGCTCTTCGGGGTAATTCTGCGCTTCCATGTCTCTTTTGCGATAGCCTTCTGGGCTTGCTGACCTTGATT
GTGTTCTTCACCCCCCCTCAGACTTCCTTCGCATGTCCCGCGCCGTCGACGATACCATCACCCAGAGCCTCAATGCTCTC
GTCACGCCCGCACGCGCCGGCTTCGACCCTGCATCCACGGCCACCCGTGTATACCCTTCTGCTTCTCCGTCCCACTCATC
CTCCCGCTTCTCACCCTCACCATCCGCCTGCCGAAATTTTCGTGATTCTGTGCTCTTCCCCGCCTGGCAGGCACGCGACG
ACGTCATCCGATACTGTACCGGCGTTGCCGAGGCGGCCGAGGCGGCAGCAGCAGAAAAGGCCGACAAGAAGGATGGCCTC
CCAGACGCCCTCGACGCCTCCGACCCCCGCCTCACTGAACGCTACGACCCCTACATCCGGCGGCGGCGCTTCGCCGAGGT
TGAGCCCGAGGCCGATCGCCTGGCTGCCCTGATGCGACAGGAGCGCGGTGTGGAGACGATTGTGCGTGCCCGCTCGTGGG
AAGTGTTGCAGAACCGCTGCGGCACTGGCATCACGACCGGCATCGAGAACAGCAGCTGGGAGGCCGCGCTGGACCGGTGG
CGGCTGCGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62