GenePrediction:GLEAN_6767 Details

Name: GLEAN_6767
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:154978..152545 (- strand)
Length: 2434
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:154978..154054 (- strand)
Length: 925
Type: CDS
Source: GLEAN
Position: GCSC_156:154001..152545 (- strand)
Length: 1457
>GLEAN_6767 class=GenePrediction position=GCSC_156:154978..152545 (- strand)
ATGCCCCAATTACTCAGCAGCCGCGATGCCAACCTGTTCCGCCAGGTCATCCGCAACTATGAGGAGAAGGAGTACAAGCG
CGGCCTCAAGGCAGCCGAGCAGATCCTCAAGAAGAATCCGCGACATGGCGACACGATGGCGATGAAGGCGCTGATTCTCA
ACGGCCAGGGAAAGACGGACGAGGCGTTTGCGCTGGGCAAGGAGGCGCTGACGGTGGACATGAAGTCGCACATCTGCTGG
CACGTGTACGGGCTGCTATATCGAGCCAACAAGAACTTTGAAGAGGCCATCAAGGCATACAAGTTTGCCCTGCGGCTGGA
GCCCGAATCGCCGCAGATCCAACGTGACCTGGCGATTCTGCAGGTGCAGATGCGCGACTATGCCGGCTACGTGCAGAGCC
GCCAGGCCATCCTGCAGGCACGGCCGCAGCAGCGAATGCACTGGACCGGCCTGGCCATTGCCCACCACCTGGCCGGCAAC
CTGGCCGAAGCCGAGCACATCCTGACCATGTACGAGGACACGCTGAAGAACGAGCCGCCACGCACCGACGTTGAGCACTC
CGAGGCGCTGCTGTACAAGAACGCCATCATCGCCGAGACCGGCGACATCCAACGGGCGCTCGACCACCTCGAGTCGGCCG
CAGCTGACCGGGCGCTCGACCGGCTTGCCGTGCTCGAGACCCGTGCCCGCTACCTCACGCTGCTGGGTGCCGACCGCAGC
ACCGATGCGGCCGTGGCCTGGCGCGCCCTCATCGACCGCAACCCGGACAACTCCAAGTACTACGAGGGCCTCGTGCAGAC
CCTCGGCCTTGCCGACGACCAGAGCCCCGAAGCCACAGCCACACGTCTCGCCGTGCTCGACGAGTACTCGGCCAAGTATC
CCCGGAGTGATGCTCCGCACCGTCTGCCGCTCAACTTTCTGACAGGTGAGTTTGCGTCTGATTGTTCGGCCGGCAGCTGT
TCCTGCTGACATCCCAGGCGACCTATTCAAGGAGAGGGCACGAAAGTACCTGTTCCCAATGCTTGACAAGGGCATCCCAT
CGCTGTTTGCCAACGTCAAGCACCTCTATGCCGACGAGGCGAAGAAGGAGGCGCTGCGGATGCTGGTGGAGGAGTACCTG
GCTGCACACAGCTCGGACGAGGCCAAGGCGAACGGCGCAGACGAGAAGAAAGATGCGTCCAAAGGCGAGGGTGCGGCGCT
GTACTACCTGGCACAGCACCACAACTACTATCGCAGCCGGAACCTGGACCAGGCGGACGTGTACTGCGACCGGGCGATCG
GGTTGGACGGCAAGAGCGTGGACTTCCAGATGACCAAAGCGCGGATATGGAAGCACCGGGGCGACCTGCAGAAGGCGGCC
GACGCGATGGATGCGGCACGACAGCTGGACACACGCGATCGCTACATCAACAGCAAGGCGGCCAAGTACCGGCTGCGGAA
CAATGAGAACGAGGCGGCGATCAAGACGATGGGCCTGTTCACGCGGCCAGAGTCGGCAGCCGACCCGCTGGCCGACCTGC
TGGAGATGCAGTGCGTGTGGTATCTGACGGAAGACGGCGAGGCCTATGCGCGTCGCGGCAACGAAGGTCTTGCGCTGAAG
CGTTTCCACGCCGTCAGTGCCGTCTTTGACGTCTGGCAGGAGGACCAGTTCGATTTTCACGCCTTTTCGCTGCGCAAGGG
CATGATCCGCGCCTATGTCGACCTGGTCCGCTGGGAGGACCGGCTGCGCGAGCACCCATTCTTCACACGCGCCGCTCTGG
ATGCAGCCCGGCTGTACGTGGCCAAGTTTGACCACGCACAAGGCAGCGGCGACAAGACGGCCAACGGCACCGCCGGGGCC
AACGGCAACGCGTCGGCAGAGGCTTCACCACCGTCGGCAGCCGAGGCGGCCGAGAAGAAGAAGGCGGCCAAGAAAGCCAA
GAAAGAGGCGCTGCGGGCCGAGAAGGAGACGGCCGAGAAGGCGGCCAAGCAGGACCCGAACAAGGCCACGGCAGCGGCAG
CTGACGCCGGCGAGATCAAGAAGAAGGACGATGATCCGCTCGGCCTCAAGCTGGCCGCCACGGCTGATCCGCTGGCCGAG
GCCACCAAGTTTGTTGCGCCTGTGCTGCAGTTTAGCCCCAAGAGCCTGGAAGGCCAGCTTGTCGGCTTTGACATTTATCT
ACGACGGAGTGAGTTTTTTTTTCTTTTTTTTCTTTTTTTTTTCCTTTCTTTCTTTCTTTTTCTTTCTTTCTTCTTTTCTT
TTTTCCTTTTCGCTGACTGTACAGATAAATTCCTGCTGGCCCTACGCTGCCTCAACGCAGCCCGCGCGCTCGACGCTGAC
AATGCGCGGGTCAAGGAGCAGACGGCCGAACTGCGGCGTGCACTCGACGCAACCGCCGTGGCCAAGCTGCCGGCTAAGGT
GCAGGAGGTCCTGGCGGCCGAGTTTAAGGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62