GenePrediction:GLEAN_6768 Details

Name: GLEAN_6768
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:151509..150180 (- strand)
Length: 1330
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:151509..151471 (- strand)
Length: 39
Type: CDS
Source: GLEAN
Position: GCSC_156:151400..150180 (- strand)
Length: 1221
>GLEAN_6768 class=GenePrediction position=GCSC_156:151509..150180 (- strand)
ATGAACTACGCCAGCATGATTGACGAAAAAGGTCTAAAGGTACGCATATTCACCTCTCGAAGAAAGCCTGTCCGAACATC
TCTCCACTCACACCGCTCCTCGTCTCCAGAAAGGCTTCATCGTCGCCACCCTCATCTCCACCATCATCGGCACCTTCACC
ACCGGCATCGGCCTGTACGATCGTATCCGTGACCACTCCCGCCAGCACCACACCGACCACGCGCAGGACCACAGGATCGA
CGATCTCGAGCATCGCATTGACCGCCTCGATCGCCGTGACCGTCTCGACCGACACGATGGTTTTGGCGGCGGCGCCGGAT
ACCTCTCGCCCAACGCGGTCGGCGATGCCGTCTATGCGGCCCTCTCATCTGCGCCTACGGCTATCCGCCGCGAGTACGAG
GGGCTCCTGGCTTCTGCCGGTCCTCGTTTCGCCCAAGGAGACGCCACGGCCCGCCTCCAGCTGCAGGCCCTCCTCATCGA
CCTGCAGTCGTCTGTGATTCAGCAGCTGCAGGAAGCCCTGGACCGCCGCAGCTACCGCCGCAGTTCGAGCAACCCCAGAG
GCGGGAGAGTGGACGATCGGTACGGCTTCTCATCCGAGCGTCTGGCCGAGGCTGCAGACCGCGCTCGCAACGGCAGCATC
CGCGCTCTGCGGGAACAGCACCAGCGCCTGCTGGAAGACTCTACACCGCACCGACCGCTCTCCCACCACTCCAACGACTA
TCTGGAATATGCCGATGGCCGTGAGGACACCGGCCTGTTCTGTCCCTACGCCCTGCAGCTGCAGCGCAACCCCCGGACGC
CGATGGACTTGGATCTGGACGGCGACGACACTGCCATTTCCGACACAACGGCCGCTTTCTGTCCCTCTTGCGCCGGCCGT
CTGGAGATCTCGCCAGACTACGCGTGGAAGATTCAAAAGTCCGTTGTGGTTGGCCAGCGGTTCGACAGGGATGACGATGA
CCGGGATGCCGGTAGAAATCACCACAGAAGAGGCGCTAGTATGCACTCGCACAGTGTTGTTGATGACGTCGAGGACCGCG
TTTTCGTGCTCAGCAACCGATTCGTCGTCAAGTGCCACCAGACCGCCAAGGTGGTTGAAGACCATGAGAGCCGCCACGCC
GGGTTTTCCATGCTGAAGCCGTCGTACGCTTGCTGTCTGTGCGAGGAGCGCGGGCGCTATTCCGGCCGTGGGCGGAGCTC
TTCATCCCGCGTGGCCGTGTGCAGCAACATGACGAACCTGGTTGACCACGTGTGTGACGAGCACAGCATCAAGGAGCTGA
TGGCAGACCCAGACATTCACGAAGTCGAGCCGCGGCGGGAGCGGTGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62