GenePrediction:GLEAN_6769 Details

Name: GLEAN_6769
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:148669..147649 (- strand)
Length: 1021
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:148669..148618 (- strand)
Length: 52
Type: CDS
Source: GLEAN
Position: GCSC_156:148544..147649 (- strand)
Length: 896
>GLEAN_6769 class=GenePrediction position=GCSC_156:148669..147649 (- strand)
ATGGCATCCTCAGCGGCTTCTATGCCGTTTATCAAAAACCTCGCCTCCAGCGGTAAGTAGCTTGTGAGGAAGAGAATAGA
CGAAGTGCATGTGAAGCGTTTTGCTGACAGACTCTGGGCCAACAGACCGCAGGACGCGCACACAGTCGCTCGACACGCTC
AAGGCATTTCTGTCGACAAAGTATGCCGGCCCTTCGACGTCGGTGCCGCTCAGCTTCCTCGACGCACATAAGCTGTGGAC
CGGCCTGTTTTATGCGCTCTGGATGGCGGACCGAGCGCCAGTGCAGCAGCGGCTGTGCGACGAGTTGGCGGGGCTGCCGG
CAGCCGTAGGGCTAGCAGACGCCTCGACGGTGGCGTGGCTGCGGGGGTTCTGGGCCATCATGGCGCAGCGGTGGACGACG
GGCATCGATGTGCTGCGGATGGACAAATTCCTGCTGTTGGTGCGGCGGGTGTTGGCGGCACAGCTAGCATGGATGGCAGG
CAGCGTGGGAGGGGAGAAGAAGAAGCAGAAGAAGACACAGGCGAAAGCGGCGGCTGTGCAGTCGCTGGCGGCCGAGACGG
CAGGTCTGTCGGTGCTGCAGGACTGGCCGCTAAACCCAGAGGCAGAGACGCCGGTGGACGACGGCCAGGATGAGGACCAA
TTGGAAGATGGCGGCGAGAAGCGATGGACGCGGAAGCGGGTGCAGGCGACGGTGCGCATCCCCGTTGGCTTGGCGATGCA
CGTGCTGGACATCTGGGTGGACGAGGCCGAGAAGCTGGGGCTGCTGGCCGAGGCTGAGGCGACAGAGGCGACAGAAGCGA
GCGATGCAGCCGGCCGGCCATCTCTGGTCCGCAACGTCAATGCGCTGGTCGAGACGCTGGCAGCGCAGACGAGGTCGCCA
GCCGTTCGCAAGCACGCGCGCGAGGCCTTGACCGACGAGCGGCTGCCGTGGAACGAGAAAGCCGAGGAGAGCGCGGACGA
GGCCAACAGCGACGAGGACGAGGACATGGCAGACAACGGAAGCTGGGACGGGTTCGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62