GenePrediction:GLEAN_676 Details

Name: GLEAN_676
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1383779..1385732 (+ strand)
Length: 1954
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1383779..1384015 (+ strand)
Length: 237
Type: CDS
Source: GLEAN
Position: GCSC_97:1384162..1384247 (+ strand)
Length: 86
Type: CDS
Source: GLEAN
Position: GCSC_97:1384305..1384412 (+ strand)
Length: 108
Type: CDS
Source: GLEAN
Position: GCSC_97:1384514..1384561 (+ strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_97:1384614..1385320 (+ strand)
Length: 707
Type: CDS
Source: GLEAN
Position: GCSC_97:1385380..1385732 (+ strand)
Length: 353
>GLEAN_676 class=GenePrediction position=GCSC_97:1383779..1385732 (+ strand)
ATGAACAGAGCAGTTGCTGATGCCGGCGAGACAGCGTTGCCGGAGCGGCCTGCTGGCATGGAAAACACCACGGCTGTCAA
CGACAAGCTGCAGGATCCGCCACGGGCGCTGTACGGCTGGCGTCTGCACATGAGCGTGCTCGGACTCTCGCTGGCCCTCA
TGTTCTCGGCCCTCGAGACGACCATCATCTCGACCGCTCTCACGACGATCGGCATGTCCTTCAACAACTTTGCCGCCGTC
GGCTAGGTCGTCACAGCCTACCTCGTTACCTACAGCAGTACGGACCGGCTGCTGTATTGTCCATGTTGCTGCTCACTGGC
TGACCGGCTCGTCCCATAGGCTTTCCCCTGGCCTACTCTAAGCTGACCGACATCTTTGACCAGCGCAACTGCCTCCTCTT
TGCGCTTGTCTGGTTTGCCCTCTTCTCTGGACTCTGTGGCGGCGCCCAGAATATGCCGCTGACAACGCTGTGCGTGCTTC
GCCGACAACCACGGCTTTCCCACGCCGGACGCTGACCTCGCTGCAGCATCGTCTTCCGCGCCCTCCAGGGTGTCGGCGGC
TCGGGCATTTATGCCGTCGTCTTTGTCACCATTGTAGACATTGTACGCGTCCGTCCGGTCCTGTCGCCTCTTCAGTTTGC
TGACTAGTACGGTGTCCGGCTAGTCTAGTTGGCGCGTATTCGGCTGTCGTCTCGTCCACCTTTGCCATTTCCAATGTGTT
GGGCCCCATCATCAGAGGCGCCATTTGCAGCACCGGCGACTGGAAATGGATCTTTTTGCTCAAGTATGTGCCGGAGCCCT
CGAGCCGGACACATCTTGGCTGACCCTTGTGACAGTGTCCCCGGGGCTGCTCTCGCACTCGCCATTGTCTTCTTCTCTCT
GCCCGGTGGCGACGGACACGGCTTCAGCACAGCCCATCTGCGTCGGCTCGACGTCGTCGGCGCCTTTCTTTCCATTACCT
GCGCCGTCCTGTTGCTCTACGGCCTGCAGACAGGCGGCGACGAGCATCCGTGGAGCGACGCCCAAGTCATCGCCACACTC
ACTGTCGGCGGCTTCTGCATTCTCCTCTTCTTCGGCTGGGAGCACTGGCGTATGCGCCGGGCCGCACACTCGCCCATCGA
GCCCATCTTCCCGCTCCGCCTGCTCGTCAGCAAAAAGGTCACCCTCCTACTCCTGGCCGCCTTCTTCCAGGGCTGCGTCT
TTTACGCCTCTGTCATCAACATGCCCCAGCTCAATCAGATCGTCCGCCAGTCCTCGGCCACCATGGCTGGCGTCCGCACC
CTCCCCATCCTACTGCCCATGACTTTTTCTAGCTTCGTGTCTGGTGTGATCCTCTCCAAGACGCTCCGCTTCGCCTGGCA
CATGCTTGCCGCCGGATCTGTGCTCACTGCCCTCGGTGTCGGCCTGCTCATCGAAGTCCCCTTTAGCTCCGCTACTCTCG
CTCGCAACTACGGCTTTGAGGCCATCCTCGGCGTCGGCATGGGCTTCACCATGGCCACCTTTCTCATTCTCGGCCGTGTC
ATCGTCCAGGACCGTGATAATGGTATGTTTCAAGTCCCACCTCGTTCTTTCCTTCTCTCCGTCATGACCTTCCTCCTGCA
GTCGTGATGATAGGGTCGGTTAACATGATGCGCACAATGGGCGGTTGTATGGCCTTATCCAGCGTCCAGGCCATCCTTCA
CAGTCAGCTTCCCCGGCGGTTGAGCTTTCTACCAGATGACGTCGTCTCCGATTTGATTGACGCTCCCACTACCGTTATCA
AGACATTATCAGCTGCCGAAGCGCTCGAGGTGCGTCGTCGGTTCAACGACGTGTATCGCTTGAGCTTTATCATGGTTTCA
GCCCTTGGTGGCGTCGCCGTGCTAATGTCGACGCTCCCGCTGTTTCTTCGCAAAACGAAATCCACAAAGAGGGAGACCTG
TGTCGTAGTCGGACCAGAAATGTCCAAAGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62