GenePrediction:GLEAN_6770 Details

Name: GLEAN_6770
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:139085..138460 (- strand)
Length: 626
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:139085..139056 (- strand)
Length: 30
Type: CDS
Source: GLEAN
Position: GCSC_156:138855..138460 (- strand)
Length: 396
>GLEAN_6770 class=GenePrediction position=GCSC_156:139085..138460 (- strand)
ATGGCTTACCTGAAGAGTGCGGCACTACGAGTAAGAATTGGGTTTCACAATATTACAATGACTGTATCGACACAACCCAG
ATTAAGAACCAGATTTTGAGGCGTCGTTTTCCCACCATTTTGACCTTTTCAAAACGCACCGAAAATTTTCGGCTCCAATT
CTCCAATAGCCATTTCTCAGATAATAACTGGTCGAAACTCGAGTGATTATAAAGATACAGACGAAGATAGAGGTTCCCCC
CTGGTCCGGTCCAAGATCAAGAAGCTCCTCCGCCATATCATCCGGAGCCTGAGGCCTCCAACTGTACAAACACCACCCGC
AACACCGAATGCGAGGTTCGCTTGCGGAGCGGAGACGTGGGCCTAGCCGACATCATCGCCGAAAAGTCAGGGGGGCCTGC
AACAGCCATCGCTAAGGTCATCTACACGGCTGCCTATGCCGTATCGAGTGATCTTGTGGCCGAGACCGTCACCAATATAT
CCGAATGCATCCAAGCCACCCTCGAGGCTATCGATGACCTGTCACAAGAAGACAGAGACACAGTCGCCCCCGCTATGGTG
ATATCAATCACCAATGCCGTTAAAATGGTGGCTGCGTTGGGCCAAGACACATCATCGGTGGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62