GenePrediction:GLEAN_6771 Details

Name: GLEAN_6771
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:132772..131284 (- strand)
Length: 1489
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:132772..132315 (- strand)
Length: 458
Type: CDS
Source: GLEAN
Position: GCSC_156:132250..131284 (- strand)
Length: 967
>GLEAN_6771 class=GenePrediction position=GCSC_156:132772..131284 (- strand)
ATGCTGATCCAACAGTTCCAGCGGCCGACTCGGCTTCTGGCCGTCTTTGCAGCAGTCTCTCTCGTCTATCTCTGCCTGAG
CTACCTGCAGCGCATCGATTTCACTGCCTGCAGCATCGTCCCTCCCAACACGGTCAACGGCAAGTTTGGCACCACAGAGC
AGATTCTGGCACAGCCAGCGACGCTGTCGAACCGGCCGACAGCCCGTGTGGCCAAGGTCGGCGTGGCCGTGAACGCCCTC
GACATCCCGGTCGTATACCGCGCGTTCAAATCCCACAAGGTCCAGAATGACATGCACGGCTATCCGCATTTCATTGCCGA
CAACGAGGTGGTTAGCAGCCTAACCGACAACGATGTCTTCCGTCGTGGCTCAGGCACCTACACGAAGCCGGCCTACATGC
TGGCCATTATGATCGCGGAACTGCTTAAGCCAGAGTCTGAGCGCCTGGAATGGCTTTTGTGAGCTCACTCCCGCCCGTCC
TGACCACTTCCTCTGGCTACAACTAACGCAATCTCCTGACAGCTGGTTCGACGGTGACACAGCCATCCTAAACCCCTCCA
CGCCGCTCGAGGTCTTCCTCCCGCCCAACTCCAGCGCCATCCTGAATGACGTTCACATTGTCATTGCGTCTAACTGGGAT
GGCCTCAACTCCGGTGCCTTCGCCCTCCGTGTGCACAAATGGACGGCCTCTTTCCTCTCTGCCGTCTTGGCCTACCCCAT
CTACGAGCGGGATCGCACAAAGCACGACCGCTTCCGGGACCAGAGCGCCTTCCAGTTTCTGTTGAAGCATACCGACTCGC
CGCTAGTTCACGAGCGGTTCCAGTCCCGGAACCACTGGGCTGAAGTCCCGATGCGGTGGTTCAACTCATTGCCGGTCAAC
AATGCCTTTTACGCAGACGGCCGGTGGCTGTTTAGCAAGAATATGACAGAGGCGACGTTTGACAACGGCACAACACAGGT
GTACGACGATGGCCGAGACGGCAAGGTGCAGTCGTGGAAGGTGATGCGAGGTGATATGATGGTGCACTTTGCGGGTACAA
AGAACGTGCGCGACAGTTGGATGTCGCCATGGCTCGATCGGGCTGAGCAGATGCTGCCCGAGTGGAACAACGCGACGTAC
TCGGAGGAGCTGGCCAACACCACAGCCGCTTGGTGGAAAGACTATGAGACGAAAGCGAAAGCTTTGTACGAGGCACCAGC
ACCGCCGCCAGCCAAGGAGAAGCCCAAGGAGGAGAAGCCAAAAGAAGAGAAGCCAAAGGAAGAGAAGTTCAAAGAAGCGA
AGTCAGAAGAGGCGAAACAGGAGAAGTCGAACGAGAAAGACACAGAGAAGTCCAAGGACAGCAAACAGTCCGAGGACAAA
GACAAGGACAAGTCGGAGAAGCCGCTGGAAAAGCAAGCATCGGAGGGGAGCACGAAGACAGCAGAGGCCGAGAAGGCGTC
CGAGTCGGTGGCAGCGACACCAGAAAAAACAAGCAGCGGCCAGCAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62