GenePrediction:GLEAN_6772 Details

Name: GLEAN_6772
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:130217..129032 (- strand)
Length: 1186
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:130217..129525 (- strand)
Length: 693
Type: CDS
Source: GLEAN
Position: GCSC_156:129457..129032 (- strand)
Length: 426
>GLEAN_6772 class=GenePrediction position=GCSC_156:130217..129032 (- strand)
ATGGCCCGACCCATGGATCTGGAGGCACAGCGCAGCGACCTTAACGGTGGCGGCCACGAGAGCCTGAACGACGAGAGCCG
CGAGAAGCTCTTTGAGAAGGACGGACAGGATGAGCAGAACAGCAGCAGCAGCAGCAGCTCGTCATCTTCGGGGCTCTCGA
CGTCCAGTTCGGCCTCGTCCACGCTCGATGCGGCCGAGTACACGGCGTCGGCAACGAGCAAGTGGGCGTATCTGGCGTCA
TACTTTGCCTGCAATGTGGCGCTGACGCTCTACAACAAGGGCATCCTCGGCCGGTTCGCGTATCCGTGGCTGCTCACGGC
GATCCACACGGGTTCGGCCTCGATCGGCTGCTACATTTTGCGAATGCGCGGCAAGGTCACGCGCACAGCATTGTCACGGC
AGCAGGAGTCTGTCCTGCTCGGCTTCTCCGTCCTCTTCACCATCAACATTGCCATCAGCAACGTGTCGCTGGCCATGGTG
TCTATCCCCTTCCACCAGATCATGCGCTCGACCTGTCCCGTCTTCACCGTGCTGATCTACCGCCTCCGCTACGGCCGCAC
CTACGGCACCCGCACATACCTCTCGCTCGTGCCTGTTGTGCTCGGTGTCGCCCTCGCCACTTACGGCGACTACTACTTCA
CTGCTACCGGCTTTCTCCTCACCTTTCTCGGCGTCTTGCTGGCCTCGGCCAAGGTACGTGCTGCCTGAAAGAAGTTGGAC
GTCTTTCCGACTCGATTTGTTTCCCTGCTAATTGTGCCAGACTGTTGCCACCAACCGGATCATGACTGGCCCGCTCGCAC
TCTCCCCTCTCGAGTCCCTCATGCGTATGTCCCCCTTGGCCTGTATCCAGGCCCTCCTGTGCTCCGTCCTCTCGGGCGAG
ATCTCGCGCATCACAGACGGATACACCGTCGTACCCATCAACTCGCACATGTTCTGGGCGCTGGCCGGCAACGGCGCCCT
CGCCTTCGCCCTCAACCTGGCATCTTTCAGCACCAACCGCAAGACTGGCGCCCTTACTATGACCGTCTGTGGCAACGTCA
AGCAGAGCCTGACCGTGCTATTGGGCATCACCATGTTCGGCGTCAAGGTCGGCGTGGCCAACGGCATCGGCATGTTTGTT
GCCCTCGTCGGCGCTGCCTGGTACAGCGTCGTGGAGCTGGGAGCAAAGGCGCCAGCTCGACGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62